Genipin, a herbal medicine is known to have both neuroprotective and neuritogenic activity in neuronal cell lines. In this study, we evaluated the neuroprotective effect of novel genipin derivative on sodium-nitroprusside (SNP)-induced apoptosis in retinal ganglion cells , and further investigated its action mechanism in signalling pathways. The effects of CHR20/CHR21 against SNP-induced toxicity, oxidants/antioxidant defences and survival signalling pathways were investigated in in retinal ganglion cells.CHR20/21 significantly inhibited SNP-induced cell toxicity and the generation of reactive oxygen, and significantly induced the expression of Gclc mRNA . In the signaling pathway, CHR20/CHR21 effectively blocked SNP-induced inactivation of Akt and ERK1/2 pathways through the elevation of Phosphorylation Akt and Erk1/2. These results indicate that CHR20/CHR21 has neuroprotective effects against SNP-induced apoptosis in RGC-5 cells via inhibited SNP-induced the generation of reactive oxygen and actived the antiapoptotic cellular signalling pathways.
Keywords: Apoptosis PI3K/Akt ERK1/2 retinal ganglion cell
Introduction
The glaucomas is a group of complex and heterogeneous ocular diseases.With the growing evidences collected from clinical and experimental studies over the past decades, it is strongly suggested that the involvement of the reactive oxygen species(ROS) plays a role in glaucoma. (Neufeld AH.1999; Ferreira SM et al.2004; Kumar DM, et al.2007). Retinal ganglion cells (RGCs) are susceptible to oxidative stress (Kumar DM, et al.2007; Mainster MA,et al.1987; Organisciak DT et al.1998). As glaucomatous damages are mostly irreversible, many glaucoma researchers are searching for a neuroprotective strategy for RGCs.
Genipin, a herbal iridoid compound,reported to have the neuroprotective activity of genipin in PC12h and Neuro2a cells against 6-hydroxydopamine, hydrogen peroxide and serum-free conditions (Yamazaki et al. 2001b, 2008). And its stable derivative (1R)-isoPropyloxygenipin (IPRG001) induced neuroprotection against H2O2 insults in a neuronal precursor cell line of retinal origin, RGC-5 and retinal ganglion cells (RGC)both in vitro and in vivo (Koriyama et al. 2010).The underlying toxicity of these insults is partly ascribed to reactive oxygen species(ROS).
Nitric oxide (NO) is a labile free radical that is physiologically produced through the L-arginine/NO synthase (NOS) pathway, and its overproduction can initiate neurotoxic events under pathological conditions (Dawson andDawson, 1996). The production of NO is implicated in neurodegeneration in animal models and ischaemic cultured cells via stimulation of reactive oxygen species (ROS) production (Bondy and Naderi, 1994; Kuppusamy et al., 1995). In biological systems, NO reacts with superoxide anions (O2•-)resulting in the formation of peroxynitrite (ONOO-), which induces lipid peroxidation (LPO) linked to the disruption of cell membranes, leading to release of cell organelles. To withstand these effects, organisms have developed enzymatic and non-enzymatic antioxidant systems to alter or convert, and thus inactivate, these ROS (Silva et al., 2008).
Recent reports indicate that activation of the PI3K/Akt pathway serves as important survival signals (Barber et al., 2001; Dudek et al., 1997; Nunez and del Peso, 1998; Politi et al., 2001). Akt is activated following phosphorylation at Serine 473 and Threonine 308 after PI3K activation (O'Gorman and Cotter, 2001).Activated Akt then exerts its anti-apoptotic effect by phosphorylating multiple targets downstream.it has been reported that PI3K/Akt pathway may serve as an endogenous regulator of caspase activation in axotomized RGCs.(Zelda H. Cheung et al., 2004)Extracellular signal-regulated kinases 1/2 (Erk1/2) pathway mediates the survival and axon regeneration of adult rat retinal ganglion cells (RGCs)(Vincent Pernet et al., 2005). Recent studies using pharmacological inhibitors of MEK1 have implicated the Erk1/2 pathway in the control of adult RGC death (Choiet al. 2003; Diem et al. 2003). For example, methylprednisolone-induced inhibition of Erk1/2 increased RGC apoptosis in a model of experimental autoimmune encephalomyelitis (Diem et al. 2003). Taken together, these data underscore the importance of the classical Erk1/2 pathway in the survival of adult injured RGCs.
In this study,we modulated Structure of genipin derivative IPRG001as CHR20/CHR21,and investigated the mechanisms of action of CHR20/CHR21 pretreatment on RGCs under oxidative stress using transformed RGCs (RGC-5 cell line).
Materials and reagents
MDA detection kit (Beyotime Institute of Biotechnology ); BCA protein assay kit(Beyotime Institute of Biotechnology) ;RPMI-1640 medium (GIBCO) ;Fetal bovine serum (FBS) (GIBCO);dimethylsulfoxide (Sigma) ;Hoechst33342 were purchased from Beyotime Institute of Biotechnology;SNP and Dichlorofluorescein diacetate (DCFH-DA) kits were bought from Sigma; phospho-eNOS (Ser1177),Anti-phospho-Akt (Ser473) and phospho-ERK1/2 antibodies were purchased from Cell Signaling Technology (Woburn, USA); The anti-β-actin antibody was bought from Sigma;Poly-d-lysine(Sigma, USA). PI3-K inhibitor LY294002, Akt inhibitor , ERK1/2 inhibitors PD98059 were obtained from Calbiochem (La Jolla, CA, USA).
Cell culture and treatment
RGC-5 cells, were grown in 75-cm2 tissue culture flasks in RPMI-1640 sup-
plemented with 10% heat-inactivated fetal bovine serum (FBS),, penicillin (100 IU/mL), streptomycin(100 mg/L),. Cultures were maintained at 37 °C in 95% air-5% CO2 in a humidified incubator and passaged every 3 to 4 d. RGC-5 cells in logarithmic phase were seeded into 96-well ã€12-well or 6-well plates coated with 0.1 mg/mL poly-D-lysine (Sigma) and allowed to grow for at least 24 h. Different concentrations of CHR20,CHR21 (3, 10, and 30μmol/L) were added to the culture media for 2 h followed by addition of SNP (750 μmol/L) for 24 h. In some experiments,RGC-5 cells were pretreated with LY294002,PD98059,Aktâ…§ for 30min then treated chr20,chr21 and were exposed to 750 μmol/L SNP for the next 24 h.
MTT assay
RGC-5 cells were cultured at a density of 6000 cells per well in 96-well plates. MTT (5 mg/mL) was added to10 μl/100 μl of medium was added to each well after the aforementioned treatments and the plates were incubated
for 3h. After centrifugation, the supernatant was removed from each well, and the cells were lysed with dimethylsulphoxide (DMSO) and the absorbance was recorded with a microplate reader (Bio-Rad model 680) at a wavelength of 490 nm. Each experiment was performed in triplicate.
Detection of apoptosis
RGC-5 cells were cultured at a density of 30000 cells per well in 6-well plates. , cells were incubated with Hoechst 33342 (5 μg/mL) diluted in phosphate-buffered saline (PBS) for 10 min at 37 °C before detection using High content screening system(ArrayScanVTI, Thermo Fisher Scientific, USA).
Measurement of reactive oxygen species (ROS)
Intracellular accumulation of ROS was measured using fluorophotometric quantitation. The cells were cultured with chr20,chr21(30 μmol/L) for 2 h before exposure to SNP (750μmol/L) for 12 h. The harvested cells were subsequently stained with DCFH-DA for 30 min at 37 °C. The cell suspension was dispensed into 96-well black plates. DCFH-DA reacts with ROS and is converted to dichlorofluorescein (DCF).The fluorescence from the DCF was analyzed using a High content screening system(ArrayScanVTI, Thermo Fisher Scientific, USA) with the excitation wavelength set at 488 nm and the emission wavelength set at 525 nm.
Estimation of lipid peroxidation
MDA reacts with thiobarbituric acid (TBA) to produce a fluorescent product. Levels of MDA were measured in RGC-5 cells lysates with a microplate reader at a wavelength of 535 nm. RGC-5 cells were treated with CHR20/CHR21 2h prior to exposure to SNP and left to grow to more than 90% confluence in 6-well plates. Cells were harvested and washed with PBS after 24 h. The method described in the MDA detection kit was employed from Nanjing Jiancheng Bioengineering Institute, Nanjing,China.
RT-PCR Analysis
RNA from cultured PC12 cells was extracted with use of TRIzol (Invitrogen, Carlsbad, CA, USA) following the manufacturer's protocol. The mRNA quality was evaluated by the OD260/280 ratio and samples were only used when the ratio was 1.8-2.0. Reverse transcription was performed using All-in-One First-Strand cDNA Synthesis Kit (Gene-Copoeia, USA) according to the manufacturer's instructions.
The PCR program (34 cycles) consisted of denaturation for 5 min at 94 °C and 94 °C for 30 s, annealing at 55 °C for 30 s, then extension at 72 °C for 1 min, and extension at 72 °C for 5 min. Manganese Superoxide Dismutase (MnSOD) primer sequences were: forward:5'- CTCCCTGACCTGCCTTACGACT -3'; reverse:5'- AAGCGACCTTGCTCCTTATTG -3'. glutamate cysteine ligase catalytic subunit (GCLC) primer sequences were forward: 5'- TCAAAGGCCTCTAAGCCAGA -3'; reverse:5'- AGATCTCCGTGTCGATGGTC -3'. catalase （CAT） forward: 5'- GAGGCAGTGTACTGCAAGTTCC-3';reverse:5'-GGGACAGTTCACAGGTAACTGC -3'.Glutathione peroxidase （GPX）forward: 5'-TCCACCGTGTATGCCTTCTCC -3'; reverse:5'- CCTGCTGTATCTGCGCACTGGA -3'. heme oxygenase-1 （HO-1）forward: 5'- AGCATGTCCCAGGATTTGTC -3'; reverse:5'- ACCAGCAGCTCAGGATGAGT -3' RPL-19 was chosen as the internal control. RPL-19 primer sequences were: forward; 5′-ATCGCCAATGCCAACTCT-3′; reverse:5′-GAGAATCCGCTTGTTTTTGAA-3′. The PCR products were examined on 1.2 % agarose gels with ethidium bromide
staining. Results were normalized with those for RPL-19.
Statistical analysis
Data are expressed as the mean±standard deviation. Ananalysis of variance (ANOVA) followed by a Newman-Keuls post-hoc test was performed to assess the differences between groups. Values of P<0.05 were regarded as statistically significant.
Results
To examine the cellular tolerance to CHR20/CHR21, RGC-5 cells were treated with the drug at the concentrations ranging from 1 to 30μM for 24 h. The cell viability was determined based on the reduction of MTT by mitochondrial reductase in the viable cells. As shown in Fig. 1B, CHR20 and CHR21 did not show toxicity up to the concentration of 30 μM. In contrast, the viability of RGC-5 cells was increased in a concentration-dependent manner when the concentrations were above 30 μM.
Figure 1.Cytotoxicity of CHR20 and CHR21 in RGC-5 cells. (A) Chemical structure of CHR01a and CHR20, CHR01b and CHR21. (B) Cytotoxicity of CHR20 and CHR21. RGC-5 cells were treated withCHR20 and CHR21 at concentrations ranging from 0 to 30μM for 24 h. The cell viability was determined by MTT assay. The percentage of cell viability was presented as mean±SD for six replicates. *P<0.05 vs control group.
Pre-incubation with CHR20 and CHR21 protected RGC-5 cells from SNP-induced injury
Before studying the protective effects of CHR20,CHR21, we analyzed the toxicity of SNP on RGC-5 cells., RGC-5 cells were treated with different concentrations of SNP for 24 h and MTT assay was carried out to determine the metabolic activity of the mitochondria, SNP was neuroprotective at low concentrations, whereas higher concentrations were neurotoxic. Exposure to 750 μmol/L of SNP induced moderate injury to the cells when compared with the control group. (Figure 2). This result confirmed NO is a Janus-faced molecule that can mediate survival signaling (Troy et al.,2000; Contestabile and Ciani, 2004) but may on the other hand contribute to neuronal death and brain damage in neurological diseases (Zhang et al., 1996),We further addressed the question of whether CHR20 and CHR21 could protect RGC-5 cells against SNP-induced injury.Exposure to 750 μmol/L of SNP for 24 h decreased the viability of RGC-5 cells to 59.0%±4.8% compared with the control group. Pre-incubation with CHR20 or CHR21 for 2h attenuated the injury induced by SNP in a dose-dependent manner. This effect was statistically significant at a concentration of 10 μmol/L (P<0.05). The cell viability after pre-incubation with CHR01a was 60.2%±1.9% of the control, while the cell viability after pre-incubation with CHR20 was 74.1%±4.3% of the control (P<0.05, Figure 3). There was no significant difference in cell viability between the CHR20 and CHR21 pre-treated groups (P>0.05).
Figure 2. The neurotoxicity of SNP on RGC-5 cells. Cells were exposed to SNP for 24 h. The cell viability was evaluated by measuring the quantity of formazan generated by activated mitochondria. The values were expressed as percentage of control, which is set to 100%. The percentage of cell viability was presented as mean±SD for six replicates. P<0.05 vs control group.
Figure 3. Effect of CHR01a and CHR20, CHR01b and CHR21, on the cell viability in RGC-5 cells induced by SNP. RGC-5 cells were pre-treated with CHR21 and CHR20 at different concentrations for 2 h before 750 μmol/L SNP was added. The percentage of cell viability was presented as mean±SD for six replicates. ##P<0.05 vs control group. *P<0.05,**p <0.01vs SNP group.
CHR20 and CHR21 attenuated the SNP-induced apoptosis of RGC-5 cells
Analysis of Hoechst 33342 stain with a fluorescence microscope revealed that pretreatment with CHR21 or CHR20 significantly decreased the apoptosis of RGC-5 cells induced by SNP. CHR20 pretreatment alone showed no effect on apoptotic bodies or the nuclear morphology of RGC-5 cells. Pre-treatment with CHR21 and CHR20 (30 μmol/L) attenuated nuclear fragmentation and chromatin condensation, and inhibited apoptosis at the early and intermediate stages of SNP exposure. There was no statistically significant difference in the percentage of apoptotic bodies between the CHR20 and CHR21 groups (Figure 4).
Figure 4. CHR20 and CHR21 protected RGC-5 cells from apoptosis induced by SNP. RGC-5 cells were pre-treated with CHR20 or CHR21 for 2h before 750 μmol/L SNP was added. (A) Cells were stained by hochest33342, and detected by flow cytometry. (a) control group;(b) 750 μmol/L SNP group; (c) 750 μmol/L SNP+30 μmol/L CHR20 group; (d) 750 μmol/L SNP+30 μmol/L CHR21 group; The percentage of apoptotic body was presented as mean±SD for three individual experiments. ##P<0.05 vs control group. **P<0.05 vs SNP group. The arrow indicates nuclear fragmentation or chromatin condensation.
CHR20 and CHR21 protected against the production of SNP-induced ROS and decreased SNP-induced MDA accumulation in RGC-5 cells .
DCFH-DA is hydrolyzed to DCFH by intracellular esterases, which is subsequently oxidized by ROS to DCF, which is a fluorescent compound. The fluorescence intensity is directly proportional to the amount of ROS generated from SNP expo-
sure. Using an excitation wavelength of 488 nm and an emission wavelength of 525 nm, the mean fluorescence intensity increased to 142.7%±8.11% in the SNP-treated group compared with the control group. Pre-incubation with 30 μmol/L of CHR20 or 30 μmol/L of CHR21 resulted in a decrease in the mean fluorescence intensity to 91.4%±10.0% or 78.6%±4.6%, respectively, compared with the SNP-treated group (Figure 5).There was no statistically significant difference in the levels of ROS between the CHR20 and CHR21 groups (P>0.05). MDA, formed by degradation of polyunsaturated lipids by ROS, is used as a marker to measure the level of oxidative
stress in an organism. In our previous study, SNP increased MDA levels to 382.6%±28.2% compared with the control group. However, pre-incubation with 10 μmol/L of CHR20 or CHR21 for 2 h caused a decrease in the levels of MDA to 237.9%±17.1% or 224.4%±16.3% and in the 30μmol/L CHR20/CHR21 pretreated group decreased to128.1%±20.2% or 104.6%±14.6% (Figure 5). There was no statistically significant difference between the level of MDA and ROS in the CHR20 and CHR21 groups (P>0.05).
Figure 5. Effect of CHR20 and CHR21 on accumulation of ROS and MDA in RGC-5 cells induced by SNP. RGC-5 cells were pre-treated with 10,30 μmol/L CHR20 or CHR21 for 2h before 750 μmol/L SNP was added. Cells were stained by DCFH-DA and detected by fluorometric analysis, or followed by the MDA detection kit. The percentage of ROS and MDA were presented as mean±standard deviation for at least three individual experiments.##P<0.01 vs control group. *P<0.05 , **P<0.01vs SNP group.
Effects of CHR20/CHR21 on SNP-Induced Antioxidant Expression in RGC-5 cells
Overproduction of ROS is supposed to induce antioxidant expression, which can antagonize the effects of ROS, thereby leading to a balance between oxidants and antioxidants.We further examined the effects of treatment with CHR20/CHR21 on the dynamic changes of SNP-induced antioxidant expression. RGC-5 cells were pretreated with CHR20/CHR21 for 1h and were subsequently stimulated with SNP for up to 6 h The relative levels of antioxidant gene mRNA transcripts normalized to the control RPL-19 were determined longitudinally by RT-PCR. We found that SNP increased antioxidant mRNA transcription levels except for CAT and MnSOD, and the highest expression of HO-1 (Figure. 6), and treatment with CHR20/21 inhibited SNP induced GPX mRNA expression but enhanced the SNP induced transcription of GCLC ,MnSOD and CAT in RGC-5 cells.
Figure 6.Effect of CHR20/CHR21 on SNP-induced mRNA expression of antioxidant, Cells were pretreated with CHR20/CHR21 and/or induced with SNP for 6h and assessed for GCLC /GPX/HO-1/MnSOD/CAT mRNA.
Treatment with CHR20 and CHR21 increased the Phosphorylation of Akt,Erk1/2 in RGC-5 cells
It was reported that an increase in the Phosphorylation of Akt,Erk1/2
confers an improvement in the survival ability of cells.Thus,we measured the effect of CHR20 on the Phosphorylation of Akt,Erk1/2 in RGC-5 cells. The Phosphorylation of Akt,Erk1/2 increased in a time-dependent manner after CHR21 exposure, peaking after 40min. No change was observed in Erk1/2 and Akt expression after treated with CHR21. pre-incubation PI3K inhibitor LY294002 or Erk1/2 inhibitor PD98059 for 30min abrogated CHR21-induced Phosphorylation (Figure 6).
Figure 7. Effect of CHR21 on the Phosphorylation of Akt and Erk1/2 at different time. (A)Analysis of phosphorylation levels in RGC-5 cells by Western blotting at different time after exposure to CHR20/CHR21 and the quantification of phosphorylation levels compare to the 0 h treating group by density scanning.P<0.05 vs 0 h treating group. (B) Analysis of Phosphorylation levels of in RGC-5 cells by Western blotting after CHR21 application at different concentration and the quantification of phosphorylation levels compare to the untreating group by density scanning. (C) Analysis of phosphorylation levels in RGC-5 cells with pretreatment of LY294002(10μM)/PD98059（μM) for 30min then coapplication with CHR21 for 40min and the quantification of phosphorylation levels compared to the control group by density scanning. The percentage of density was presented as mean±standard deviation for at least three individual experiments. *P<0.05**P<0.01 vs control group. ##P<0.01 vs CHR21pretreated group
PI3K/Akt and ERK1/2 signalway invovled in the protective effect of CHR20 or CHR21 treatment on SNP-induced apoptosis in RGC-5 cells
LY294002, a PI3K inhibitor, was used to confirm whether PI3K/Akt was involved in the protective effect of CHR20/CHR21. As shown in Figure 7A, LY294002（1μM)/Aktâ…§ inhibitor（0.3μM) /PD98059(10μM) attenuated the protection conferred from CHR20 pretreatment on SNP-induced apoptosis while showing the same effect on CHR21-treated cells with LY294002（1μM)/Aktâ…§ inhibitor（0.1μM) /PD98059(30μM). As displayed in Figure 7B, CHR20/CHR21 had no effect on the expression of total Akt and Erk1/2 compare with control group, but it significantly increased the phosphorylation of Akt and ERK1/2 respectively. Not only the phosphorylation of Akt and ERK1/2 but also total Akt and total Erk1/2 remarkably decreased in RGC-5cells after exposure to SNP for 12 h, treatment with CHR20/CHR21 significantly increase the phosphorylation of Akt and Erk1/2 compared with the expression of the SNP-exposed group.and pre-incubation with LY294002 /Akt â…§ and PD98059 for 12h reversed this effect.
Figure 8. LY294002 and PD98059 inhibited the protective effect of CHR20/CHR21 against SNP-induced apoptosis in RGC-5 cells. RGC-5 cells were pre-treated with LY294002 and PD98059 for 30min,then treated 30μmol/L CHR20, CHR21 for 2h and further exposed to 750
μmol/L SNP for the next 24 h. (A) Effect of CHR20 and CHR21 on the cell viability in RGC-5 cells by MTT assay. The percentage of cell viability was presented as mean±standard deviation for six replicates. (B) Effect of CHR20/CHR21 on the ratio of p-Akt and p-Erk1/2 in RGC-5 cells. The percentage of density was presented as mean±standard deviation for three individual experiments. *P<0.05 ,**P<0.01 vs control group. ##P<0.01 vs CHR20/CHR21 pretreated group+ SNP group.
Discussion
Several clinical studies have demonstrated that Oxidative stress is a risk factor for the development of neurodegenerative diseases, including glaucomatous visual field deterioration(Neufeld AH.,1999; Ferreira SM et al., 2004; Kumar DM et al., 2007) . Apoptosis of RGCs is known to be a fundamental pathogenesis in a variety of retinal degenerative diseases, such as glaucoma and diabetic retinopathy (Quigley et al., 1995; Barber et al., 1998; Lafuente et al., 2001).
Therefore, we employed RGCs cells culture conditions to investigate the effects of CHR20/21 on RGC-5 cells in vitro. Our results demonstrate that CHR20/21 enhances mesangial cell survival, and CHR20/21 significantly ameliorated SNP-induced cell apoptosis, ROS and MDA production in a dose-dependent fashion. These findings suggest that CHR20/CHR21 has therapeutic potential for the prevention or treatment of apoptotic neuronal death. We also investigated the antioxidative effect of CHR20/21 on SNP-induced cellular oxidation products in RGC-5 cells, SNP increased the levels of oxidation products such as ROS and MDA. However, CHR20/CHR21 significantly decreased SNP-induced productions of ROS, MDA. We also investigated the expressions of HO-1,MnSOD, CAT, GPx and Gclc mRNAs in RGC-5 cells by RT-PCR. We observed up-regulation of HO-1,Gclc,GPX mRNA in SNP-induction, and treatment with CHR20/21 inhibited SNP induced GPX mRNA expression but enhanced the SNP induced transcription of GCLC ,MnSOD and CAT in RGC-5 cells. suggesting that part of the early stress response in neurons is to increase intracellular levels of GSH, suggesting that GSH plays an important role in protecting RGC-5 cells during SNP-induction. The production of O2•- in NO-related insults is emphasized by results showing overexpressing SOD are resistant t o brain ischemia (Kinouchi et al., 1991). From these results, SNP not only increases the peroxidation levels, but also cause protection of neurodegeneration. The increased expression of HO-1 may also reflect an elevation of antioxidant defence mechanisms as a response to oxidative stress (Kaspar et al. 2009; Kurauchi et al. 2009) These data indicate that CHR20/CHR21 may improve the antioxidant capacity of RGC-5 cells and protect RGC-5 cells from oxidative injury to some extent.
Although the precise mechanisms underlying protective of CHR20/21 on SNP -induced RGC-5 apoptosis are not fully understood, many reports have suggested that the PI3K/Akt signaling and Erk1/2 pathway might play an important role in the development of RGC apoptosis (Zelda H et al. 2004 ;Vincent Pernet et al., 2005) . it has been reported that that PI3K activity and/or the axotomy induced increase in p-Akt level may play a physiological role in attenuating RGC apoptosis by inhibiting activation of caspase-3 and/or -9. It's also(Shiow L. Pan et al. Cardiovascular Research 61 (2004) 152-158)observed that sodium nitroprusside-induced vascular smooth muscle cells apoptosis via a cGMP- and phosphatidylinositol 3-kinase-involved inhibition on Bcl-2 down-regulation/cytochrome c release/caspase-3 activation cascades. And recently reported that, although both the Erk1/2 and the PI3K pathways are stimulated in RGCs upon TrkB activation in vivo, only the Erk1/2 pathway mediates survival of axotomized RGCs (Cheng et al. 2002) In this study,We also observed that CHR20/21 activated both Akt and Erk1/2 phosphorylation.PD98059, a MAPK inhibitor and PI3K inhibitor LY294002 inhibited Akt and Erk1/2 phosphorylation respectively.These results suggest that CHR20/21 probably promote RGC-5 cells survival through the PI3K/Akt and ERK1/2 pathway.
In summary, our data demonstrate that CHR20/21 ameliorates SNP-induced cell apoptosis, ROS and MDA production, and Antioxidant expression. In addition,
CHR20/21 inhibited the expression of GPX under SNP conditions and upregulated GCLC levels under normal conditions in a time dependent manner in RGC-5 cells. We showed that activation of the PI3K/Akt and Erk1/2 signaling pathway is involved in mediating the RGC-5 cells protective effects of CHR20/21.Our findings may provide a new basis for the design of therapies for the treatment of diabetic progressive renal diseases.
