The placenta is a remarkable transient organ which is vital for fetal growth and development. There are several functions of placenta, including anchoring the concepts, protecting fetus from the rejection of maternal immune system, and transporting the nutrients, wastes and gas between the fetus and the mother[1]. The trophoblast cells are contribution to the formation of placenta through the proliferation and differentiation. Dysregulation of trophoblast function, such as dysregulation of apoptosis, cell invasion and cell proliferation, may lead to a range of gestational diseases, including intrauterine growth restriction and preeclampsia [2-4].
In the early development of placenta, the human trophoblast differentiates into villous and extravillous trophoblasts [5]. Cytotrophoblast (CT) stem cells are the precursors of the differentiated villous cell type, such as syncytiotrophoblasts (ST) and extravillous cytotrophoblasts (EVT)[6]. During the implantation of blastocyst, villous cytotrophoblasts cells fuse to form ST [6]. On the other hand, EVT of fetal origin invade the uterine spiral arteries of the deciduas and myometrium[7]. Then the endothelial layer of the maternal spiral arteries are replaced by these invasive cytotrophoblasts, and transformed to high-caliber capacitance vessels which can provide adequate placental perfusion to maintain the growth of fetus[7]. Placental development requires precise control by different agents such as cytokines, regulatory transcription factors, specific genes, hormones, and growth factors [6, 8].
Members of transforming growth factor (TGF) β are closely associated with tissue remodeling events and organs reproductive processes, including the development of placenta [9, 10]. This multifunctional protein family consists of a large group of growth and differentiation factors, including TGFβ proteins, bone morphogenetic proteins (BMPs), Activins/Inhibins, growth and differentiation factors (GDFs), as well as Nodal and its related proteins[11].
Nodal was first cloned from a 7.5 day post-coitum mouse embryo cDNA library and found to be predominantly expressed in the central nervous system [12, 13]. Nodal exerts its important roles in embryogenesis [14-16] by signaling through its activin receptor complex containing a type II activin receptor ,ActRIIA or ActRIIB, and a type I receptor, ALK4 or ALK7[17]. In the general Nodal signaling pathway, mature Nodal binds to the type I and type II activin receptors, resulting the phosphorylation of Smad 2 and Smad 3. Then the Smad 2 /3 associates with Smad 4 to form a Smad complex, which will translocates into the nucleus to interact with specific transcriptional factors [18, 19]. Previous studies of hypomorphic Nodal mutation in mice by Grace T. Ma et al (2001) showed that Nodal can act directly to inhibit the giant cell differentiation on trophoblast [20], suggesting that Nodal is involved in the placental development. Interestingly, we have reported that Nodal acts through ALK7 and Smad2/3 to inhibit proliferation and induces apoptosis in human trophoblast cells in human placenta [10].
MicroRNAs are a class of naturally occurring small non-coding RNAs that post-transcriptionally regulate gene expression [21-24]. It has been identified to regulate gene expression by targeting 3'untranslated regions (3'UTR) of mRNAs, resulting in cleavage or translational repression [25, 26]. Specifically, near-perfect complementarity between the miRNA and its target mRNA results in complete degradation of the targets, whereas partial complementarity leads to translational inhibition. MicroRNAs have been shown to involve in many biological processes, i.e., cell proliferation[27, 28], division [29, 30], cell differentiation [31-35], apoptosis[36], and development of placenta[37, 38].
To further study the regulation of Nodal-ALK7 signaling pathway in human trophoblast cells, we use FindTar to analyze the interaction between miRNAs and the 3'UTR of Nodal. We have found that miR-378* has complimentary binding sites on the 3' untranslated region (UTR) of Nodal mRNA. The expression of miR-378* is highly variable among different tissues in mammal[39]. Lee et al (2007) reported that miR-378* (formally known as miR-378) enhances cell growth in vitro[40]. Recently, expression of the miR-378* was reported to mediates metabolic shift in breast cancer cells by regulating ERBB2[41]. However, little is known about the function of miR-378* in placenta development.
In this work, we examined the effect of miR-378*on Nodal expression and cell survival, cell invasion and cell migration using trophoblast cell lines (HTR8/SVneo). We showed that miR-378* induced cell survival, invasion and migration in part by targeting Nodal. Incorporation of miRNA regulation on Nodal-ALK7 signaling pathway in trophoblast growth will lead us a better understanding of placenta development.
Results
miR-378* suppress the expression of Nodal by targeting its 3'UTR.
To determine whether Nodal can be regulated by miRNAs, we used Find Tar to predict miRNAs that could potentially target the Nodal 3'UTR. miR-378* was identified to have the potential excellent complementary target site at the 3'UTR of Nodal from nucleotides 183-204 ( Fig. 1A). Luciferase assays were performed to confirm whether miR-378* can target Nodal 3'UTR. Human trophoblast cell line HTR8/SVneo was co-transfected with a Nodal 3'UTR-luciferase construct or the construct in which the miR-378* target site was mutated (Fig. 1A).It was found that miR-378* decreased luciferase activity in Nodal-luc-transfected cells, but did not affect luciferase activity in Nodal-mu-transfected cells, indicating that Nodal is the target of miR-378* (Fig. 1B).
To investigate how miR-378* interacts with Nodal 3'UTR and represses its function in trophoblast cells, we generated the stable cell lines by using a construct expressing miR-378* or GFP control[40]. The RT-PCR result confirmed the expression of mature miR-378* on the stable cell line (Fig. 1C). RT-PCR analysis detected no difference, indicating that miR-378* does not repress Nodal at the translational level (Fig. 1D). However, a clear reduction of Nodal expression was observed in the cells stable expressing miR-378* compared with the control group by western blot (Fig. 1E).
To further test the repression effect of Nodal by miR-378*, the stable cells expressing miR-378* or control GFP were respectively transfected with antisense expression constructs against miR-378* or a control vector to perform the western blot analysis[42].The levels of Nodal were higher in both of cell lines transfected with the antimiR-378* expression construct than the control vector transfection (Fig. 1F), confirming that Nodal expression was suppressed by miR-378*(Fig. 1F)
To corroborate this result, a siRNA construct harboring two hairpin structures complementary to Nodal sequences (Fig.S1). HTR8/SVneo cells respectively transfected with miR-378*, siNodal, control oligos or mock (Depc Water). After post-transfection, cells were respectively transfected with Nodal plasmids with or without 3'UTR fragment, then cell lystaes were subjected to western blot probed with anti-Nodal antibody. The results revealed that cells double transfected with miR-378* and Nodal with 3'UTR vector, but not cells double transfected with miR-378* and Nodal without 3'UTR vector, decreased Nodal protein levels (Fig. 1G-H). It indicated that miR-378* repressed the expression of Nodal by targeting its 3'UTR. Similarly, siRNA Nodal also inhibited Nodal expression (Fig. 1G-H).
miR-378* promotes trophoblast cell proliferation, survival.
To study the effect of miR-378* on trophoblast cell development, we first determined its function on cell proliferation and survival. The stable cells expressing miR-378* or control GFP vector were maintained in serum-free conditions or in serum-containing conditions and allowed to overgrow, resulting in extensive cell death. It was observed that the miR-378* stable cells enhanced cell survival compared with the control in all serum conditions by microscopic examination (Fig .2A and Fig 2.C). The similar survival experiment was also carried out by using transient transfection, indicating that miR-378* induced cell survival.
To further corroborate this result, cell survival assay were performed using mock transfection, Nodal siRNA and miR-378* oligo. It showed that the cells transfected with Nodal siRNA or miR-378* oligo induced cell survival (Fig. 2D), suggesting that Nodal might be involved in miR-378*-enhanced cell survival.
miR-378* induced trophoblast cell invasion and migration.
We have previously shown that Nodal acts through ALK-7 to inhibit cell invasion and migration in trophoblast cell (In press). To study the regulation of miR-378* on Nodal signaling pathway, we tested the effect of miR-378* on trophoblast cell invasion and migration. HTR8/SVneo cells were transit transfected with miR-378* or empty control oligos, and half of them were pre-treated with mitomycin C 10ug/ml for 2hr to eliminate cell proliferation. Cells that were subjected to perform transwell cell invasion assay. It was observed that miR-378*, with or without mitomycin C treatment, significantly induced the number of cells passing through the matrigel (Fig. 3A). We also confirmed the induction effect of miR-378* on trohpoblast cell invasion by using stable cell lines (Fig. 3B). To further test the effect of miR-378* on cell invasion, stable cell lines expressing miR-378* or control GFP were respectively transfected with antimiR-378* or control vector to perform invasion assay. Again, miR-378* stable cells exhibited enhanced cell invasion and GFP stable cells tranfected with anti-miR378* repressed the endogenous miR-378* expression, which led to a reduction in cell number (Fig. 3C).
To determine the function of miR-378* in trophoblast cell migration, wound healing assays were performed in the stable cells. A wound was made when miR-378* and GFP stable cells were grown till confluent cell layers. The ability of cells to migrate into the wound area was monitored and quantified. These experiments showed that the miR-378* stable cells migrated much faster than the controls [Fig. 3D].
miR-378* targets Nodal and reverses its inhibitory effect on trophoblast cell invasion.
To further test the hypothesis that miR-378* regulate trophoblast cell development in part by altering Nodal signaling pathway, the "rescue" experiment was performed. HTR8/SVneo cells were respectively transfected with miR-378* or empty control oligos. After post-transfection, cells were respectively transfected with Nodal plasmids with wide type 3'UTR, Nodal plasmids without 3'UTR, or EV and allowed for 24 hr invasion. A significant reduction of the invasive cell number of the cells, which co-transfected with miR-378* and Nodal plasmids without 3'UTR, was observed (Fig. 4B). However, this phenomenon could not be observed when cells co-transfected with miR-378* and Nodal plasmids with 3'UTR (Fig.4A).
miR-378* stimulates explants outgrowth.
Placenta explants were used as model to further assess the role of miR-378* in cell invasion and migration of trophoblast cells. Explants from a 9 week placenta were treated with miR-378* or control oligos, then tissues were culture in matrigel and subsequent cell invasion and migration from gel -attached villi were monitored daily using microscopy. The area of miR-378* transfected explants outgrowth had a significant expansion compared with the control group (Fig. 5).
Discussion
Expression of miR-378* represents an important regulator to promote cell survival and tumor growth [40]. Until recently, it have shown that miR-378* regulates metabolic shift in breast cancer cells [41] and achieves oncogenic transformation by targeting the anti-proliferative BTG family member TOB2 [43]. However, target genes and function of miR-378* in placenta development have not been reported. The novel finding in this paper shows that miR-378* promotes cell survival, proliferation, migration and invasion in trophoblast cells by suppressing the expression of Nodal.
Computational analysis showed that Nodal was a potential target of miR-378*. Direct evidence of miR-378* targeting Nodal was obtained form luciferase activity assays. Consistent with our hypothesis, extensive western blot analysis showed that miR-378* expressing cells decreased endogenous Nodal expression compared with the GFP control cells, whereas inhibition of miR-378* by anti-miR378* induced endogenous Nodal expression. Furthermore, we observed that the effect of miR-378* could be reversed by overexpression of Nodal without 3'UTR, but not the Nodal with 3'UTR. These finding confirm that Nodal is a target of miR-378*.
In this study, we found that miR-378* promotes cell survival and cell proliferation in trophoblast cells, which consistent with Lee's finding that miR-378* enhanced cell survival [40]. We have been reported that Nodal inhibits proliferation and induces apoptosis via ALK-7 [10], knockdown of Nodal using siRNA also resulted in high levels of cell survival. These results suggest that the role of miR-378* on cell survival is mediated, at least in part, by down-regulating Nodal expression.
Our study provided evidence that miR-378* induced cell invasion and cell migration. We found that miR-378* transient transfected cells significantly induced trophoblast cell invasion, the similar phenomena was also observed in miR-378* stable expressing cells. Furthermore, inhibition of endogenous miR-378* by anti-miR378* in GFP control cells suppressed cell invasion, confirming the promotion effect of miR-378* in cell invasion. Moreover, miR-378* expressing cells enhanced cell migration and the miR-378* transfected explants significantly induced the area of explants outgrowth. These results indicate that miR-378* promotes trophoblast cell invasion and migration. Importantly, we found that the roles of miR-378* in inducing cell invasion and migration at least in part by targeting Nodal. The "rescue" experiment showed that the invasive effect of miR-378* could be reversed by over-expression of Nodal without 3'UTR, but not Nodal with wild type 3'UTR. These findings further support that miR-378* promotes cell invasion and migration, in part by inhibiting Nodal expression.
In summary, we have demonstrated that miR-378* promotes trophoblast cell survival, proliferation, invasion and migration, and that it exerts these effects by targeting, at least in part, Nodal expression. Future investigation will further clarify the role of miR-378* in placenta development.
Materials and Methods
Cell lines and Cell Culture: The immortalized first trimester trophoblast cell line HTR8/SVneo was obtained from Dr.Charles Graham (Queen's University). It was established from normal human trophoblast cells by transfected with a plasmid containing the simian virus 40 (SV40) large T antigen (Taq)[44]. HTR8/SVneo cells were cultured in RPMI1640 medium (invitrogen) supplemented with 100 units/ml penicillin, and 100 µg/ml streptomycin (invirtogen) in the presence of 10% fetal bovine serum (Hyclone).
Stable cell Generation: The plasmid that expressing miR378* was developed in Dr.Burton Yang's Lab and is expected to simultaneously express a small fragment of RNA and produce GFP[40]. Stable cell lines were generated as described in ref [40, 42].The mRNA expression levels were confirmed by RT-PCR.
RNA Extraction and RT-PCR-Cells (5.0Ã-105) were harvested, total RNA was extracted using TRIzol reagent (Invitrogen) following the manufacturer's protocols and stored at -80 °C until RT-PCR analysis. Three micrograms of total RNA was reverse-transcribed into cDNA in a total volume of 20 μl using 80 μmol of oligo(dT) primer (Amersham Biosciences) and 200 units of Moloney murine leukemia virus reverse transcriptase (New England Biolabs Inc., Mississauga, Ontario, Canada). The reaction was carried out at 42 °C for 1 hr in 1Ã- reaction buffer (50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, and 10 mM dithiothreitol) containing 10 mM dNTPs, and 10 units of RNase inhibitor (RNAguard, Amersham Biosciences) and terminated by heating the mixture at 90 °C for 10 min. An aliquot of the cDNA sample (2 μl) was subjected to PCR, which was performed in the presence of 10 mm Tris-HCl (pH 8.3), 2.0 mm MgCl2, 50 μm deoxynucleotide triphosphate, 1 unit of Hotstar Taq (QIAGEN Inc., Mississauga), and 10 pmol of primers for 25-40 cycles depending on the cDNA target to be amplified. Primers for Nodal, mature RNA and the internal control GAPDH are listed in Table I. The annealing temperature for PCR is 60°C.
RNA Extraction and RT-PCR for miRNA-Cells (5.0Ã-105) were harvested, total RNA was extracted using TRIzol reagent (Invitrogen) following the manufacturer's protocols and stored at -80 °C until RT-PCR analysis. Three micrograms of total RNA was added a tail of mRNA in a volume of 10 μl using 0.5 μg of oligo(dT) primer (Amersham Biosciences), 25nM Mncl2, 10mM ATP, 0.5 μl Polymerase (Amersham Biosciences) and 5 μl 5x PolyA Buffer (Amersham Biosciences). The reaction was carried out at 37 °C for 30 min. Then, the RNA was added 0.5 μl oligo adaptor dT primer (New England Biolabs Inc., Mississauga, Ontario, Canada) and heated for 5 min at 60 °C. Later the RNA was reversely transcribed into cDNA in a total volume of 20 μl at 50 °C for 1 hr in 1Ã- reaction buffer (50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, and 10 mM dithiothreitol) containing 10 mM dNTPs, 1.5M DTT and 1 μl Reverse Transcriptase SIII and terminated by heating the mixture at 95 °C for 10 min. An aliquot of the cDNA sample (2 μl) was subjected to PCR, which was performed in the presence of 10xPCR buffer, 5 μM 3'URP, 0.4 μl dNTP, 1 unit of Hotstar Taq (QIAGEN Inc., Mississauga) and 1 μM of primers for 25-40 cycles depending on the cDNA target to be amplified. Primers for mature miRNA and the internal control U6 are listed in Table I. The annealing temperature for PCR is 60 °C.
Cell survival Assay: miR378* stable Cells or GFP control cells (1.0Ã-105cells per well or 1.5Ã-105cells per well) were seeded on the 35mm Petri dishes in RPMI1640 medium containing 0-10%FBS. Cells were incubated for different time periods and cell number was counted by using trypan blue staining [40].
Cell invasion assay: A 5.0 um polycarbonate membrance with a 6.5 mm cell culture insert (Costar, Corning incorporated, NY) was used to perform matrigel invasion assay. The upper surface of filter was coated with 1/40 dilution of growth factor reduced Matrigel (BD Biosciences, Bedford, MA). To determine the effects of miR-378*, HTR8/SVneo cells were transfected with 200nmol of miR-378* or neglect control oligos (Gene Pharma, Shanghai) for 5h and recovered with RPMI1640 containing 10% fetal bovine serum overnight. This experiment was repeated by using stable cells. To further confirm the effects of miR-378* on cell invasion, cells transfected with miRNA or nonspecific control as previous described, were treated with 10µg/ml mitomycin C (Sigma, Canada) for 2h to inhibit the cell proliferation. To perform the rescue experiment, cells transfected with miRNA or nonspecific control oligos as previous described, were transfected with Nodal (with or without 3'UTR) or control plasmids after post-transfection. Then, 2.0Ã-105cells in 200ul RPMI1640 medium with 1% fetal bovine serum were seeded on the top of each chamber, whereas the lower compartments were filled with 600 ul of the same medium mentioned above with 10% fetal bovine serum. After incubation for 24 h, noninvaded cells on the upper surface of the filter were wiped out with a cotton swab, and the invaded cells on the lower surface of the filter were fixed and stained with a Harleco hemacolor stain set (EMD, NJ). Invasiveness was determined by counting cells in 9 microscopic fields per well, and the extent of invasion was expressed as the whole number of the invaded cells.
Wound healing assay: A wound was made using a 200ul pipette tip when miR-378* stable cells and GFP control cells were grown in 6 well Petri dishes near confluency. Ten different points were marked randomly and distance migrated by the cells was monitored, photographed and measured by simple PCI software program (Compix Inc.,Township, PA) at 24 hr and 48h after wounding.
Protein extraction and Western blot analysis: Cell lysates were prepared from miR378* stable cells, GFP control cells, and HTR8/SVneo cells transfected as previous described. Cell lysates were prepared by radioimmune precipitation assay buffer (50 mM Tris-HCl, 150 mm NaCl, 1% Triton X-100, 0.5% deoxycholate, and 1% SDS) and protein concentrations were quantified. Protein samples were subjected to SDS-polyacrylamide gel electrophoresis and blotted onto a nitrocellulose membrane. The membrane was blocked with TBST (10 mm Tris-Cl (pH 8.0), 150 mm NaCl, and 0.05% Tween 20) containing 5% nonfat dry milk powder (TBSTM) at room temperature for 1h. Then membrane was incubated in a primary antibody (rabbit anti-Nodal polyclonal antibody) at 4 degree overnight. After TBST washing, the membrane was incubated with HRP-anti-rabbit secondary antibody at room temperature for 1hr. Signals were detected using an ECL Kit (Amersham Biosciences) followed by the instructions of the manufacture.
luciferase activity assays: The Nodal mutated sequence was amplified using two primers, 5′- ACAGAGGCTGCTGTGTCCTAGAGGGAGGAAG -3′ and 5′-CTTCCTCCCTCTAGGACACAGCAGCCTCTGT -3′. The copy of mutated sequence and Nodal3′-UTR (nt183-204) target binding site sequence was PCR-amplified using two primers, 5′-TGACATCCTGGAGGGAGAC -3′ and 5′-CAATAAAGCCATTGTCTAG -3′. The two copies of sequences were cloned into T-esay vectors (Promega Corp. WI, USA), using two primers, 5'-TGACATCCTGGAGGGAGAC-3' and 5'-CTAGACAATGGCTTTATTG-3'. Then subcloned the T-easy vectors into downstream of the stop codon in pRL-TK (Promega Corp. WI, USA). HTR8/SVneo cells were plated 24 hr prior to the transfection in 12-well tissue culture plates. The next day, cells were co-transfected 200 ng of luciferase report vectors and 40ng of Renilla vectors with 25 nM of miRNA-378* or neglect control oligos (Gene Pharma, Shanghai) using Lipofectamine 2000. Cell lysates were collected and assayed 24 hr after transfection. Firefly and Renilla luciferase activities were measured using a Dual Luciferase Reporter Assay System (Ascent Software Version 2.6) and each transfected well was repeated in four times.
First Trimester Human Placental Explant Culture: Small villous explants from a 9 week placenta were dissected and placed on transwell inserts (Millipore, Corporation, USA) pre-coated with 200µl of undiluted phenol red free matrigel (BD Bioscience) in a 24-well culture plate. Explants were allowed to attach to the matrigel overnight and then supplied with serum-free culture media supplemented with 100 units/ml of penicillin, 100 units/ml of streptomycin, 2 mM L-glutamine, 100 µg/ml gentamycin and 2.5 µg/ml fungizone and incubated at 37°C with 3% O2 and 5% CO2. After two days of culture establishment, all the villous tips were carefully observed under the dissecting microscope and only those with successful EVT outgrowths were selected for treatments with recombinant Nodal (rNodal, 250ng/ml. R&D Systems, Minneapolis, MN) or Nodal siRNA (Table I). All siRNA were synthesized by GenePharma Co.(Shanghai, China). Explants were photographed before and after treatment using a Leica DFC400 camera attached to a dissecting microscope and explants outgrowths were measured by ImageJ software. Area of outgrowth was determined by subtracting the total outgrowth area at the end of the experiment (72hr post treatment) from that of the initial area before treatment. Each treatment was done in triplicate and each experiment was repeated four times using different placenta.
1. Maltepe, E., A.I. Bakardjiev, and S.J. Fisher, The placenta: transcriptional, epigenetic, and physiological integration during development. J Clin Invest. 120(4): p. 1016-25.
2. Udayashankar, R., et al., Characterization of invasive trophoblasts generated from human embryonic stem cells. Hum Reprod.
3. Herr, F., N. Baal, and M. Zygmunt, Studies of placental vasculogenesis: a way to understand pregnancy pathology? Z Geburtshilfe Neonatol, 2009. 213(3): p. 96-100.
4. Whitley, G.S. and J.E. Cartwright, Trophoblast-mediated spiral artery remodelling: a role for apoptosis. J Anat, 2009. 215(1): p. 21-6.
5. Huppertz, B., Molecular markers for human placental investigation. Methods Mol Med, 2006. 121: p. 337-50.
6. Lunghi, L., et al., Control of human trophoblast function. Reprod Biol Endocrinol, 2007. 5: p. 6.
7. Wang, A., S. Rana, and S.A. Karumanchi, Preeclampsia: the role of angiogenic factors in its pathogenesis. Physiology (Bethesda), 2009. 24: p. 147-58.
8. Cross, J.C., L. Anson-Cartwright, and I.C. Scott, Transcription factors underlying the development and endocrine functions of the placenta. Recent Prog Horm Res, 2002. 57: p. 221-34.
9. Jones, R.L., et al., TGF-beta superfamily expression and actions in the endometrium and placenta. Reproduction, 2006. 132(2): p. 217-32.
10. Munir, S., et al., Nodal and ALK7 inhibit proliferation and induce apoptosis in human trophoblast cells. J Biol Chem, 2004. 279(30): p. 31277-86.
11. Massague, J. and Y.G. Chen, Controlling TGF-beta signaling. Genes Dev, 2000. 14(6): p. 627-44.
12. Tsuchida, K., et al., Molecular cloning of a novel type I receptor serine/threonine kinase for the TGF beta superfamily from rat brain. Mol Cell Neurosci, 1996. 7(6): p. 467-78.
13. Ryden, L. and K. Malmberg, Calcium channel blockers or beta receptor antagonists for patients with ischaemic heart disease. What is the best choice? Eur Heart J, 1996. 17(1): p. 1-3.
14. Zhou, X., et al., Nodal is a novel TGF-beta-like gene expressed in the mouse node during gastrulation. Nature, 1993. 361(6412): p. 543-7.
15. Chea, H.K., C.V. Wright, and B.J. Swalla, Nodal signaling and the evolution of deuterostome gastrulation. Dev Dyn, 2005. 234(2): p. 269-78.
16. Nonaka, S., et al., Determination of left-right patterning of the mouse embryo by artificial nodal flow. Nature, 2002. 418(6893): p. 96-9.
17. Reissmann, E., et al., The orphan receptor ALK7 and the Activin receptor ALK4 mediate signaling by Nodal proteins during vertebrate development. Genes Dev, 2001. 15(15): p. 2010-22.
18. Miyazawa, K., et al., Two major Smad pathways in TGF-beta superfamily signalling. Genes Cells, 2002. 7(12): p. 1191-204.
19. Schier, A.F., Nodal signaling in vertebrate development. Annu Rev Cell Dev Biol, 2003. 19: p. 589-621.
20. Ma, G.T., et al., Nodal regulates trophoblast differentiation and placental development. Dev Biol, 2001. 236(1): p. 124-35.
21. Chendrimada, T.P., et al., TRBP recruits the Dicer complex to Ago2 for microRNA processing and gene silencing. Nature, 2005. 436(7051): p. 740-4.
22. Hutvagner, G. and P.D. Zamore, A microRNA in a multiple-turnover RNAi enzyme complex. Science, 2002. 297(5589): p. 2056-60.
23. Lim, L.P., et al., Vertebrate microRNA genes. Science, 2003. 299(5612): p. 1540.
24. Lund, E., et al., Nuclear export of microRNA precursors. Science, 2004. 303(5654): p. 95-8.
25. Pillai, R.S., MicroRNA function: multiple mechanisms for a tiny RNA? RNA, 2005. 11(12): p. 1753-61.
26. Zamore, P.D. and B. Haley, Ribo-gnome: the big world of small RNAs. Science, 2005. 309(5740): p. 1519-24.
27. Yan, L.X., et al., Knockdown of miR-21 in human breast cancer cell lines inhibits proliferation, in vitro migration and in vivo tumor growth. Breast Cancer Res. 13(1): p. R2.
28. Xu, B., et al., miR-143 decreases prostate cancer cells proliferation and migration and enhances their sensitivity to docetaxel through suppression of KRAS. Mol Cell Biochem.
29. Croce, C.M. and G.A. Calin, miRNAs, cancer, and stem cell division. Cell, 2005. 122(1): p. 6-7.
30. Hatfield, S.D., et al., Stem cell division is regulated by the microRNA pathway. Nature, 2005. 435(7044): p. 974-8.
31. Kawasaki, H. and K. Taira, Hes1 is a target of microRNA-23 during retinoic-acid-induced neuronal differentiation of NT2 cells. Nature, 2003. 423(6942): p. 838-42.
32. Naguibneva, I., et al., The microRNA miR-181 targets the homeobox protein Hox-A11 during mammalian myoblast differentiation. Nat Cell Biol, 2006. 8(3): p. 278-84.
33. Li, X. and R.W. Carthew, A microRNA mediates EGF receptor signaling and promotes photoreceptor differentiation in the Drosophila eye. Cell, 2005. 123(7): p. 1267-77.
34. Chan, J.A., A.M. Krichevsky, and K.S. Kosik, MicroRNA-21 is an antiapoptotic factor in human glioblastoma cells. Cancer Res, 2005. 65(14): p. 6029-33.
35. Chen, Y. and R.L. Stallings, Differential patterns of microRNA expression in neuroblastoma are correlated with prognosis, differentiation, and apoptosis. Cancer Res, 2007. 67(3): p. 976-83.
36. Lima, R.T., et al., MicroRNA regulation of core apoptosis pathways in cancer. Eur J Cancer. 47(2): p. 163-74.
37. Zhang, Y., et al., MicroRNA-155 contributes to preeclampsia by down-regulating CYR61. Am J Obstet Gynecol. 202(5): p. 466 e1-7.
38. Pineles, B.L., et al., Distinct subsets of microRNAs are expressed differentially in the human placentas of patients with preeclampsia. Am J Obstet Gynecol, 2007. 196(3): p. 261 e1-6.
39. Reddy, A.M., et al., Cloning, characterization and expression analysis of porcine microRNAs. BMC Genomics, 2009. 10: p. 65.
40. Lee, D.Y., et al., MicroRNA-378 promotes cell survival, tumor growth, and angiogenesis by targeting SuFu and Fus-1 expression. Proc Natl Acad Sci U S A, 2007. 104(51): p. 20350-5.
41. Eichner, L.J., et al., miR-378( *) mediates metabolic shift in breast cancer cells via the PGC-1beta/ERRgamma transcriptional pathway. Cell Metab. 12(4): p. 352-61.
42. Kahai, S., et al., MicroRNA miR-378 regulates nephronectin expression modulating osteoblast differentiation by targeting GalNT-7. PLoS One, 2009. 4(10): p. e7535.
43. Feng, M., et al., Myc/miR-378/TOB2/cyclin D1 functional module regulates oncogenic transformation. Oncogene.
44. Graham, C.H., et al., Establishment and characterization of first trimester human trophoblast cells with extended lifespan. Exp Cell Res, 1993. 206(2): p. 204-11.
