Nm23-H1 is a suppressor of metastasis that has been implicated in the regulation of proliferation and differentiation of human cells. APE1 is a multifunctional protein that has an impact on a wide variety of important cellular functions and it acts on AP sites in DNA as a major member of the DNA BER repair pathway. Our study is designed to further elucidate the role of Nm23-H1 and APE1 in the human lung cancer A549 cells irradiated with X-rays.
The overexpression of Nm23-H1 and APE1 protein in A549 cells was induced by irradiation in a dose- and time-dependent manner. The change of subcellular distribution of Nm23-H1 and APE1 in A549 cells after irradiation with X-ray was converse, APE1 is localized in the nuclei of A549 cells and cytoplasmic APE1 gradually increases at 24 and 48 hour after irradiation with different doses of X-rays. Nm23-H1 was mainly localized in the cytoplasm, and nuclear localization of Nm23-H1 was gradually increased after irradiation. The interaction of Nm23-H1 and APE1 was demonstrated by His-pull down and co-immunoprecipitation. A combination of Nm23-H1 and APE1 was also detected by DNA affinity precipitation analyses of a DNA fragment containing an AP site in X-ray-irradiated A549 cells. Although AP endonuclease activity of Nm23-H1 protein was too weak to detect, the AP endonuclease activity of APE1 protein was increased with increased Nm23-H1 protein.
Conclusions
The association of Nm23-H1 and APE1 suggests a role for Nm23-H1 proteins in promoting APE1-mediated DNA BER repair pathway. These findings provide a possible mechanism by which Nm23-H1 protects cells against oxidative stress by APE1. To our knowledge, this is the first evidence of Nm23-H1 binding to APE1 at an AP site and participating in DNA repair pathway in human cells after ionizing radiation.
Key words: Nm23-H1; APE1; DNA repair; ionizing radiation
Background
Nm23-H1 was initially identified as a putative metastasis suppressor on the basis of its reduced expression in certain highly metastatic cell lines and tumors. Nm23-H1 is also a multifunctional enzyme, although its enzymatic activity provided no evidence for a role as a metastasis suppressor in tumor progression [1-2]. In humans, eight Nm23 genes have been identified. Of the eight genes, Nm23-H1 encodes a nucleoside diphosphate kinase A (NDPKA) that has been shown to be involved in a wide variety of biological activities, as it generates the nucleoside triphosphates (NTPs) necessary for DNA and RNA synthesis, protein elongation, signal transduction, etc [3-4]. Extensive studies using Nm23-H1 proteins have shown that they participate in the regulation of a broad spectrum of cellular responses, including development, differentiation, proliferation, apoptosis and DNA synthesis [5-7]. All of these reports have indicated that Nm23-H1 may participate in DNA repair of human cells. The molecular mechanisms underlying the role of Nm23-H1 as a DNA repair gene, however, have so far remained unclear.
DNA repair is fundamental to maintenance of genomic integrity. Base excision repair (BER) is a major DNA repair pathway and is responsible for correcting much of the DNA damage caused by ionizing radiation and reactive oxygen species [8]. Much of the core enzyme machinery involved in BER has been described; however, the regulation and coordination of BER with other cellular processes is not well understood [9]. Human apurinic endonuclease 1(APE1), the human AP endonuclease DNA BER enzyme, is a multifunctional protein that impacts a wide variety of important cellular functions including oxidative signaling, transcription factor regulation, cell cycle control, and cancer [10]. It acts on AP (baseless) sites in DNA as a major member of the DNA BER repair pathway. Thus, it is also a good candidate for a potential target of cancer therapy.
Although no DNA binding or DNA repair function has yet been ascribed to Nm23-H1, much evidence shows that Nm23-H1 might be involved in DNA repair and may interact with APE1. Recent results have clarified that the SET complex, an endoplasmic reticulum (ER)-associated DNA repair complex that contains three DNases (APE1, Nm23-H1, TREX1), is mobilized to the nucleus in response to oxidative stress. The SET complex was discovered as a Granzyme A (GzmA) target in cells undergoing caspase-independent T cell-mediated death [11]. Two nucleases in the complex, the endonuclease Nm23-H1 and the exonuclease TREX1, are activated by GzmA cleavage of the inhibitor SET protein to cause single-stranded DNA damage [12-13]. Although individual SET complex components have been implicated in diverse processes, including DNA repair, histone modification, DNA replication, transcriptional activation, single-stranded DNA degradation, and autoimmunity, the functions of the intact complex are not well understood [14]. Furthermore, the direct connection between the APE1 and Nm23-H1 protein in vivo and vitro are still unclear.
In this study, the overexpression of Nm23-H1 and APE1 in A549 cells was induced concurrently by irradiation in a dose- and time-dependent manner. This suggests that the expression of the two proteins is correlated with sensitivity to ionizing radiation. Moreover, we also found that Nm23-H1 bound to APE1 at an AP site in X-ray-irradiated A549 cells, and that the AP endonuclease activity of APE1 is affected by Nm23-H1. This report is the first to indicate that Nm23-H1 binds to APE-1, that this complex contacts the AP site, and that it may therefore have a role in DNA repair in human cells after ionizing radiation.
Materials and methods
Materials
Dulbecco's modified Eagle medium, Hanks' Balanced Salt Solution (HBSS), and pcDNA3.1(+) vector were from Invitrogen (Grand Island, NY). Fetal bovine serum was purchased from Hyclone (Logan, UT). Hydrogen peroxide, penicillin, streptomycin, proteinase K, RNase A, dimethyl sulfoxide, and polyvinylidene difluoride transfer membranes were from Sigma (St. Louis, MO).FuGene 6 transfection reagent was from Roche Molecular Biochemicals (Indianapolis, IN). MitoTracker Red CMXRos probe was from Molecular Probe (Eugene, OR). Tetrahydrofuran (THF) sitecontained oligonucleotides were from Takara (Dalian, China). T4 polynucleotide kinase (T4 PNK), T4 ligase, restriction endonucleases, and high-fidelity Pfu DNA polymerase was from Promega (Madison, WI). Streptavidin Agarose Resin, SuperSignal WestPico chemiluminescent reagents and horseradish peroxidase-conjugated anti-mouse or anti-rabbit IgG antibodies were from Pierce (Rockford, IL). The monoclonal antibody against hAPE1 was from Novus Biological (Littleton, CO); anti-Nm23-H1, anti-β-actin, Protein-G-agarose beads and Alexa Fluor 488-conjugated anti-HA antibody was purchased from Santa Cruz Biotechnology (Santa Cruz, CA).
Cell culture and irradiation
A549 cell was maintained in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal calf serum (FCS) and non-essential amino acids at >37°C in a humidified atmosphere containing 5% CO2. For X-ray treatment, cells were cultured in 25-cm2 flasks until they reached 75% confluence and then irradiated with different doses at room temperature, with a Precise linear accelerator (Elekta) operating at 8 MV. The design and procedures of this study were approved by Third Military Medical University.
Protein purification
Recombinant Nm23-H1 were produced and purified as previously described [15]. And recombinant human Ape1 was expressed in E.coli BL21(DE3) cells and purified by affinity chrombatography with His column as described [16,17].
Infection with adenoviruses and siRNA experiments
APE1 specific RNAi adenovirus vector named Ad5/F35-APE1 siRNA together with its control adenovirus Ad5/F35-EGFP were constructed and purified by our previous studies [18-19]. A549 cells were infected with Ad5/F35-EGFP or Ad5/F35-APE1 siRNA with increasing multiplicities of infection (MOI) for 2 h and replaced with fresh medium. A549 cells were then cultured for another 48 h and then analyzed for their EGFP intensity using a FACScan (Becton Dickinson, Mountain View, CA) or directly observed by a fluorescent microscope. The Nm23-H1 siRNA expression vector named pDC316-EGFP-U6-Nm23-H1 were constructed as previously described[19]. Forward and reverse sequences for anti-Nm23-H1 siRNA construct were as follows[20]: assay-5'GAT CCCCTGCAAGC TTCCGAAGATCTTTCAAGAGAAGATCTTCGGAAGCTTGCATT TTTA 3', assay-5'AGCTTAAAAATGCAAG CTTCCGAAGATCTTCTCTTGAAAGA TCTTCGGAAGCTTGCAGGG 3'. pDC316-EGFP-U6-Nm23-H1 and the empty pDC316-EGFP-U6 plasmids were transfected into A549 cells using LipofectamineTM 2000 (Invitrogen, CA,USA) according to the manufacturer's instructions.
Immunofluorescence and quantitation of subcellular distribution
Cells were grown on a slide at a density of 2-104 cells per well in a six-well plate for 24 h. Culture media of A549 untreated (control) or treated with X-ray for indicated times were removed and then fixed with 2% (w/v) paraformaldehyde in PBS at 4°C for 20 min. After washing twice in cold PBS, cells were permeabilized with 0.5% (v/v) Triton X-100 in PBS for 15 min at room temperature. Then cells were incubated with culture media containing 200 nM MitoTracker Red CMXRos probe for 30 min at 37°C. Slides were washed twice with PBS, then the cells were blocked with normal goat serum at 37°C for 30 min and incubated with the appropriate dilution of each primary antibody for 1 h. After extensive wash with PBS, the cells were incubated with Alexa Fluor 488-conjugated anti-HA epitope antibody at a dilution of 1:200 for 2 h. Cells were visualized with a Leica confocal laser scanning microscope(TCS SP2, Germany) equipped with 40- and 63- oil-immersion objectives, appropriate filter sets, argon(488 nm) and helium-neon lasers (543nm). Images of fluorescent cells were captured with a digital camera. For each construct and each condition, quantitation of subcellular localization was performed as follows. Between 30 and 60 cells per assay were scored for nuclear (N) and total (nuclear plus cytosolic or N+C) fluorescence intensity using the NIH Image J 1.36 program. For each cell, the nuclear fluorescence was calculated as a percentage of the total (nuclear plus cytoplasmic) cell fluorescence (N/N+C). The mean nuclear fluorescence with standard deviations for two to three independent experiments was then evaluated. Comparison of mean values obtained from different constructs and/or different conditions used a t test procedure and were performed with Minitab 13 software.
Co-Immunoprecipitation
A549 cells were plated at a density of 3.5-104 cells in six-well plates, to reach 90% confluency and then irradiated with 16Gy. Protein was collected in 0,1, 4h with an ProFound Lysis buffer(1% Triton X- 100, 150 mM NaCl, 10 mM Tris pH 7.4, 1 mM EDTA, 1mM EGTA, 0.2 mM sodium vanadate, 0.2mM PMSF, 0.5% NP-40 in PBS). Two hundred micrograms of cellular protein was incubated with 5ug of a monoclonal antibody to APE1 and allowed to rotate at 4 °C for 12 h. Protein-G-agarose beads were then added and agitated at 4°C for 4 h. The immunoprecipitated material was washed and collected by centrifugation three times in ProFound lysis buffer to remove unbound material. The final pellet was boiled in SDS loading buffer to remove the agarose beads from the precipitated proteins. Membranes were then subjected to western blotting using the Nm23-H1 antibody used for the immunoprecipitation and normal rabbit IgG used for control.
Detection of APE1 protein by His-Nm23-H1 pull-down assay
We selected the production of Nm23-H1 His-tagged proteins according to our previous studies[15]. An Ni-NTA magnetic bead (Qiagen) suspension (50 ml) was added to 500 ml of the His-tagged Nm23-H1 protein (15 mg) in a microcentrifuge tube and the suspension was incubated on an end-over-end shaker for 30 min at room temperature. After separating the supernatant, 500 ml of interaction buffer (50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole and 0.005% Tween-20, pH 8.0) was added to each tube. After mixing, this was placed on the magnetic separator for 1 min, and then the buffer was removed. APE1 (3 mg) in 500 ml interaction buffer was added to each tube and incubated on an end-over-end shaker for 1 h at room temperature, and again the supernatant was removed on a magnetic separator, and washed twice with 500 ml of the interaction buffer. The APE1/ Nm23-H1 mixture was then eluted with 50 ml of 1x SDS-PAGE loading buffer, and the presence of APE1 protein was examined by SDS-PAGE followed by western analysis with anti-APE1 antibody.
DNA affinity precipitation (DNAP) analyses
A549 cells were plated at a density of 3.5-104 cells in six-well plates, to reach 90% confluency and then irradiated with 16Gy. Protein was collected in 1,2,4h with an ProFound Lysis buffer. Two hundred micrograms of A549 cellular protein was incubated with 3ug of a DNA oligonucleotides and allowed to rotate at 4 ℃ for 12h. Oligonucleotides of 51 bp containing a single uracil at position 22 (22U),the U residue was converted to an AP site by preincubation of the 51-bp biotin-labeled oligonucleotide and the complementary oligonucleotide (22C) were synthesized[21]: assay-22U,5'-CTTGCATG CCTGCAGGTCGAUTCTAGAGATCCCCGGGTACCGAGCTCGA-3'; assay-22C,5'-CG AGCTCGGTACCCGGGGATCCTCTGAGTCGACCTGCAGGCATGCAAGC-3'.Streptavidin Agarose Resin were then added and agitated at 4°C for 4h. The protein-oligonucleotide bead complexes were washed and collected by centrifugation five times in ProFound lysis buffer to remove unbound material. The final protein-DNA complexes was boiled in SDS loading buffer to remove the agarose beads from the precipitated proteins. Membranes were then subjected to western blotting using the polyclonal Nm23-H1 and monoclonal APE1 antibody.
Western blot analysis
Cells were treated as indicated in the text. Western blot was carried out as described previously[19]. Briefly, equal protein aliquots (40 mg for whole cell) in each sample were resolved in 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis and the proteins transferred onto PVDF membranes. After blocking with 5% non-fat dried milk, the membranes were incubated with a 1:2000 dilution of antibodies against human APE1, Nm23-H1 and β-actin. The membranes were then incubated with a horseradish peroxidase-conjugated secondary antibody. The proteins were detected by an enhanced chemiluminescence detection system, and light emission was captured on Kodak X-ray films.
AP endonuclease assay
The AP endonuclease activities of APE1 were evaluated by well-characterized oligonucleotide cleavage assay. A 51-mer oligonucleotide containing a tetrahydrofuran (THF) site, which is analogue of abasic site (AP) at the 22nd position, was 50-end labeled with [γ-32P] ATP. The labeling reaction consisted of 10 pmol of the single-stranded oligonucleotide, 2.5 pmol of [γ-32P] ATP, T4 PNK and appropriate kinase buffer in a total volume of 10 ml,incubated for 30 min at 37 °C and 5 min at 95 °C. Complementary oligonucleotide was then added at 22 °C to form duplex DNA. Activity assays contained 0.5 pmol of labeled duplex oligonucleotide, 1-REC Buffer [50 mM Hepes, 50 mM KCl, 10 mM MgCl2, 1% bovine serum albumin, 0.05% Triton X-100 (pH 7.5)], protein extraction (0-3 pmol) in a 10 µl reaction volume and were incubated at 37 °C for 15 min. The reactions were terminated by adding 10 µl formamide without dyes. Equal volumes (20 µl) of the reaction products from assaying AP endonuclease activity were resolved in 20% polyacrylamide gel with 7M urea in 1-Tris-borate EDTA buffer at 300V for 40 min. Wet gels were autoradiographed at -70°C overnight.
Electrophoretic Mobility Shift Assay
Electrophoretic mobility shift assays were performed using APE1, nuclear proteins of A549 cells transfected with different doses of pEGFP-Nm23-H1 plasmid[15], and Oligonucleotides as previously described in DNA affinity precipitation analyses[21]. The U residue was converted to an AP site by preincubation of the 51-bp biotin-labeled oligonucleotide(1.5 pmol) with UDG (3.0 pmol) in reactions (20 µl) containing 50 mM Hepes-KOH (pH 7.8), 1 mM EDTA, and 5 mM dithiothreitol for 5 min at 37°C. APE1 or different nuclear proteins of A549 cells (3.3 pmol) were then added to reaction mixtures and incubated for 30 min at 0°C. Loading dye (xylene cyanol, 0.25% bromphenol blue, 10 mM EDTA, and 50% glycerol) was added, and mixtures were electrophoresed on 5% nondenaturing acrylamide gels at 30 mA for 1.5 h. The electrophoresis buffer consisted of 6.7 mM Tris (pH 6.8), 3.3 mM sodium acetate, and 1 mM EDTA. Biotin-Labeled bands in the gel were quantitated by densitometer scans (Molecular Dynamics ImageQuant) of autoradiograms.
Statistical analysis
Quantitative data were obtained from three independent experiments and expressed as mean ± SD. Statistical difference between two groups was determined using Student's t test. P values were-two sided; P <0.05 was considered as statistically significant.
3. Results
3.1. Expression and subcellular localization of Nm23-H1 and APE1 in lung cancer A549 cells after irradiation with X-rays.
Expression of Nm23-H1 and APE1 protein was detected by western blot analysis. As shown in Fig.1, dose- and time-dependent increases in Nm23-H1 and APE1 protein were observed in A549 cells after IR. Fig.1A shows that the increased expression of Nm23-H1 and APE1 in A549 cells was observed 48 hour after irradiation with increasing doses of X-rays. And at the 4 time points 0h, 24 h, 48 h, and 72 h after 4 Gy X-ray irradiation, the expression of Nm23-H1 and APE1 protein in A549 cells quickly decreased at 24 h and then gradually increased (Fig1.B). Their expression increased gradually with 16 Gy for different times (Fig.1C).
（Fig.1）
We first examined the subcellular distribution of APE1 and Nm23-H1 in A549 cells at the 3 time points after IR (Figure 2A,B). Based on fluorescence, the APE1 was localized predominantly in the nuclei consistent with the previous study[17]. In contrast to APE1, the Nm23-H1 fluorescence was found predominantly in the cytoplasm, although a low level of Nm23-H1 was also visible in the nuclei. We also found subcellular localization of APE1 and Nm23-H1 depending on time states after X-ray irradiation. Moreover, APE1 is localized in the nuclei of A549 cells and cytoplasmic APE1 gradually increases in A549 cells at 24 and 48 hour after irradiation with different doses of X-rays. Interestingly, The change of subcellular distribution of Nm23-H1 was converse to APE1, Nm23-H1 was mainly localized in the cytoplasm, and nuclear localization of Nm23-H1 was gradually increased in A549 cells at 24 and 48 hour after different dose X-ray irradiation. The representative data are shown in Figure 2C.
（Fig.2）
3.2. The alteration of Nm23-H1 expression correlated with the altered APE1 expression by knockdown and overexpression.
To determine whether Nm23-H1 expression correlated with APE1 expression, we detected the expression of Nm23-H1 in A549 cells treated with Ad5/F35-APE1 siRNA by western blotting. The results showed that decreased Nm23-H1 expression correlated with APE1 knocked down in A549 cells (Fig.3A,B). In addition, We also observed the expression of Nm23-H1 increased in pcDNA3.0 APE1 transfected A549 cells. Interestingly, the expression of APE1 also correlated with the alteration of Nm23-H1 expression. In figure 3B, the expression of APE1 was decreased in A549 cells transfected of pDC316-EGFP-U6 carrying the shRNA sequence targeted to Nm23-H1, and increased APE1 expression was also found after transfection of pEGFP-Nm23-H1 in A549 cells(Fig.3C,D).
（Fig.3）
3.3. Nm23-H1 binds to APE1 at AP site
The association of Nm23-H1 and APE1 was investigated by immunoprecipitation/ immunoblotting (Fig.4A). As described in Materials and methods, the cell protein lysates were collected 1 and 4 h after 16 Gy X-ray irradiation, then the proteins were mixed and immunoprecipitated using Protein-G-agarose beads and monoclonal antibodies against APE1. The immunoprecipitates were examined by immunoblotting using antiserum against Nm23-H1. The results indicate that Nm23-H1 binds to APE1 in X-ray-irradiated A549 cells. A similar result was obtained when Nm23-H1 protein was pulled down with the His-tagged APE1 protein in untreated A549 cells. Figures 3B and 3C show that His-Nm23-H1 protein was detected in SDS-PAGE at about 23 kDa while analysis of pull-down His-Nm23-H1 proteins with APE1 antibodies showed a band at about 36 kDa (Fig.4B, C).
（Fig.4）
Again, DNA affinity precipitation (DNAP) analyses were performed with the AP site probe with the addition of A549 cells that had undergone X-ray treatment with 16 Gy for different lengths of time (Fig.5). Interestingly, we found that Nm23-H1 and APE1 both bind to the AP site probe, especially at 4 h after X-ray irradiation. These results show that Nm23-H1 can interact with APE1 to mediate AP sites, and may therefore participate in the DNA BER repair pathway.
（Fig.5）
3.4. Nm23-H1 stimulates AP endonuclease activity of APE1.
To verify that the recombinant APE1 and Nm23-H1 protein are functionally active, the nuclear AP endonuclease activity was evaluated by a well-characterized oligonucleotide cleavage assay [17,22]. A synthetic 51-mer oligonucleotide containing a THF at position 22 was used as an in vitro substrate for APE1. The oligonucleotide was 5′ end-labeled with γ-32P, annealed with its complementary oligonucleotide, and incubated with equal amounts of nuclear fractions for 15 min. Enzymes with AP endonuclease activity cleave the 51-mer oligonucleotide 5′ to the THF site and leave a 21-mer fragment. As shown in Fig. 6A, AP endonuclease activity of recombinant APE1 protein was dramatically increased in a dose-dependent manner, while no or minimum activity was detected in recombinant Nm23-H1 protein. In addition, in mixing the two proteins, there was slightly increased AP endonuclease activity in APE1 protein with increased Nm23-H1 protein. In another experiment, we employed an electrophoretic mobility shift assay using a duplex oligonucleotide containing an AP site [21]. A biotin labeled oligonucleotide was first pretreated with UDG to remove a single uracil moiety and create an AP site on the labeled strand. APE1 or nuclear proteins of A549 cells transfected with pEGFP-Nm23-H1 were incubated with the AP oligonucleotide in the presence of EDTA to prevent AP endonuclease action. The expression of Nm23-H1 in the nuclear proteins of A549 cells was increased in a dose-dependent manner after transfection with different doses of pEGFP-Nm23-H1 detected by western blotting using the Nm23-H1 antibody (Fig.6B). Fig. 5C shows that a clear mobility shift occurs in the presence of APE1 and nuclear proteins of A549 cells; when the doses of pEGFP-Nm23-H1 plasmid transfected into the cells increased, formation of the APE1-DNA complex also increased.
（Fig.6）
（Fig.7）
Discussion
DNA repair proteins are becoming an important target for enhancing cancer gene therapy [23-25]. APE1 is a DNA repair protein that is not only responsible for repair of AP sites, but also functions as an oxidation-reduction factor maintaining transcription factors in an active reduced state. Nm23-H1 is a suppressor of metastasis and may play an important role in DNA repair. A recent report has showed that a DNA repair function is further suggested by increased Nm23-H1 expression and nuclear translocation following DNA damage in human cells. In addition, forced expression of Nm23-H1 in Nm23-deficient and metastatic cell lines results in the coordinated downregulation of multiple DNA repair genes, possibly reflecting genomic instability associated with the Nm23-deficient state [26]. Our present study found that the expressions of APE1 and Nm23-H1 were increased in A549 cells after ionizing radiation. Their overexpression was induced by irradiation in a dose- and time- dependent manner. Moreover, our results also demonstrated that Nm23-H1 was down-regulated in the APE1 knockdown A549 cells, and decreased APE1 expression was also found in the A549 cells with Nm23-H1 knocked down. Take together, it may imply a potential link between APE1 and Nm23-H1 expression in A549 cells and the expression tendency of two proteins was concurrent. Our previous study has shown that overexpression of APE1 was linked to radioresistance in human tumors and its expression may have prognostic and/or predictive significance [23-24]. These results further indicate that Nm23-H1 may be another important DNA repair gene that participates in radioresistance in human tumors. The interaction of Nm23-H1 and APE1 induced by ionizing radiation could have broad implications for understanding how BER works in human cancer cells (Fig.7). The enhancement of DNA repair in E. coli by induction of Ndk (the Nm23 homologue) [27-28] and APE1's enhancement of DNA repair and resistance to oxidative damage in lung cancer cells [18-19] may be related to the specific DNA repair activity of Nm23-H1 described in this report.
Given the fact that APE1 and Nm23-H1 are known to be involved in DNA metabolism, it seems at first sight paradoxical that these proteins are able to move from the nucleus to the cytoplasm or from the cytoplasm to the nucleus. However, it should be noted that nucleocytoplasmic shuttling has emerged in the last few years as an important regulatory mechanism for multi-functional proteins involved in DNA repair pathways and maintenance of genetic stability, such as BRCA1, p53 and so on[29-30]. One can assume that nucleocytoplasmic shuttling after X ray treatment might serve to regulate the nuclear activity of both APE1 and Nm23-H1. Another interesting possibility is that APE1 and Nm23-H1 might be involved in different cytoplasmic and nuclear processes and that spatial and temporal control of these two proteins might be an important mechanism to coordinate their activities through DNA repair pathways and/or to regulate their potential functions in DNA repair processes.
APE1 nuclease is a multifunctional DNA repair enzyme with AP endonuclease, 3'-5' exonuclease (3'-5'EXO), DNA 3' repair desterase, DNA 3'-phosphatase and RNase H activities [19, 31]. Nm23-H1 also possesses significant 3'-5'EXO activity [27, 32-33]. The 3'-5' EXO activity of Nm23-H1 has been validated rigorously by virtue of its precise coelution with Nm23-H1 protein during column chromatography. This 3'-5' EXO activity is very intriguing in light of the association of these enzymes with DNA repair processes, and the mutator phenotypes which often arise as a consequence of their deficiencies. The Nm23-H1 protein is exceedingly versatile, possessing at least three distinct enzymatic activities that could participate in DNA repair and other aspects of protecting the genome [12]. In this study, Nm23-H1 can not stimulate the AP endonuclease activity directly. However, with Nm23-H1 protein increasing, AP endonuclease activity of APE1 protein was slightly increased. And the physical association of Nm23-H1 with APE1 at the AP site, as demonstrated here, is a novel finding which suggests a potential role for Nm23-H1 in the BER of DNA in human cells. A single stranded DNA binding protein was required for human DNA excision repair [34] and molecular chaperonins have been implicated in nucleotide excision repair in E. coli [35]. Therefore, a role for accessory proteins in BER was not entirely unexpected. Data provided here indicates that Nm23-H1 can improve the AP endonuclease activity of APE1 in A549 cells transfected with Nm23-H1 plasmid vector, and we suppose that Nm23-H1 may be an accessory protein that stimulates APE1's involvement in BER in human cells.
BER is the major pathway for dealing with spontaneous hydrolytic, oxidative and alkylative base and sugar damage to DNA [36]. A key step in BER is the processing of an AP site intermediate by an AP endonuclease. The mechanisms by which Nm23-H1 associated attachment of APE1 to AP sites in DNA enhance its enzymatic attack are not understood. Furthermore, the steps by which APE1 itself interacts with AP sites in DNA are complex. Results from Demple have greatly clarified these steps by demonstrating that APE1 has a high affinity for incised abasic sites and that the incised DNA product acts as a competitive inhibitor for APE1 [37]. Relief of the inhibition by DNA polymeraseβwas demonstrated. Nm23-H1 might also relieve product inhibition. Alternatively, Nm23-H1 may alter the configuration of APE1 to a more active one. The continued binding of Nm23-H1 to APE1 seems not to be required once the correct enzyme placement occurs at the AP site.
In summary, the results presented in this paper support a model in which Nm23-H1 and APE1 interact physically and functionally to participate in DNA repair in the cell. It is notable that, although Nm23-H1 already has several enzymatic activities that may participate in DNA repair, this is the first indication of Nm23-H1 acting as a promoter in a specific DNA repair pathway mediated by APE1 in human cells. More important, to our knowledge, this constitutes the first report of an interaction involving Nm23-H1 with APE1 protein at an AP site participating in DNA repair pathway in human cells after ionizing radiation.
Conclusion
Both APE1 and Nm23-H1 play an important role in radioresistance in human tumors and their expression may have prognostic and/or predictive significance. The association of Nm23-H1 and APE1 suggests a role for Nm23-H1 proteins in promoting APE1-mediated DNA BER repair pathway. These findings about Nm23-H1 binding to APE1 at an AP site and participating in DNA repair pathway in human cells after ionizing radiation provide valuable information for the future development and use of targeted therapies, such as Nm23-H1 and APE1, for the treatment of patients with radioresistant lung cancer. To our knowledge, this is the first to reveal the precise role of Nm23-H1 binding to APE1.
