In this study, we investigated the role of liver X receptor (LXR) activation in cholesterol biosynthesis in goose primary hepatocytes. Goose primary hepatocytes were isolated and treated with the LXR agonist T0901317. Total triglyceride (TG) accumulation, intracellular cholesterol concentration, and gene expression levels of LXRα, Sterol regulatory element-binding protein 2 (SREBP-2) and 3- hydroxy-3-methylglutaryl-CoA reductase (HMGR) were measured in primary hepatocytes. We found an up regulation manner of total TG accumulation using 0, 0.01, 0.1, 1, and 10 μM T0901317, but the intracellular cholesterol concentration only showed an uptrend manner when the T0901317 concentration was under 1 μM; as compared with 1 μM T0901317, 10 μM T0901317 had an inhibiting effect (p<0.05). The mRNA levels of all the detected genes increased in the presence of T0901317. The regulation mode of SREBP-2 and HMGR gene expression is similar with that of intracellular cholesterol concentration, and the levels increased with T0901317 concentration up to 1 μM, but decreased when treated with 10 μM T0901317 (p<0.05). In conclusion, LXR activation may stimulate the cholesterol biosynthesis by activating transcription of HMGR gene, and the activation of HMGR transcription induced by T0901317 may be modulated by SREBP-2 in goose hepatocytes.
Keywords: LXRα, cholesterol, SREBP-2, HMGR, Goose
Cholesterol is an essential structural constituent of cellular membranes and also serves as a precursor for steroid hormones and bile acids. Sterol regulatory element-binding protein 2 (SREBP-2) could regulate genes implicated in cholesterol synthesis, including 3- hydroxy-3-methylglutaryl-CoA reductase (HMGR) (Wong et al., 2006), then stimulate the cholesterol biosynthesis and safeguarding the adequate cholesterol concentration within the cell (Goldstein et al., 2006). HMGR is a critical enzyme in the rate-limiting step in cellular cholesterol production. Studies in vivo and in vitro have shown that HMGR is highly regulated at the transcriptional level (Goldstein et al., 2006). Activation of SREBP-2 is dependent on the cholesterol status of the cell. When cholesterol concentration drops in the endoplasmic reticulum (ER), the SREBP-2 transcription factor is released and binds to a sterol-response element (SRE) located on the HMGR promoter. This leads to increased transcription of the HMGR gene, stimulating the cholesterol biosynthesis and safeguarding the adequate cholesterol concentration within the cell (Goldstein et al., 2006). Several nuclear receptors interact with the SREBP system to further control sterol and fatty acid metabolism. Recently, the nuclear oxysterol receptors, liver X receptor (LXR), have been shown to have critical roles in the regulation of cholesterol balance (Peet et al., 1998a; Repa and Mangelsdorf, 2000). LXRα knockout mice lose the capacity to regulate catabolism of excess dietary cholesterol in liver resulting in a rapid accumulation of hepatic cholesteryl esters that eventually leads to liver failure (Peet et al., 1998b). This effect cannot be compensated for by the related isoform, LXRβ (Peet et al., 1998b; Alberti et al., 2001). In recent years, great strides have been made in understanding the functions of LXRs in the regulation of cholesterol homeostasis. The LXRs regulate a number of genes involved in the biosynthesis, transport, and excretion of cholesterol (Repa and Mangelsdorf, 2000). A common link between SREBP-2- and LXRs-mediated processes is their regulatory response to certain oxidized cholesterol derivatives (oxysterols). Certain oxysterols inhibit SREBP-2 activation while serving as ligands for LXR (Venkateswaran et al., 2000; DeBose-Boyd et al., 2001; Janowski et al., 2001). The common physiological oxysterols are derived either from internalized lipoproteins or by de novo synthesis. A role for SREBP-2 in the positive regulation of LXR-target genes has been implied in two previous studies (Forman et al., 1997; DeBose-Boyd et al., 2001).A study showed that LXR activation up-regulates SREBP-2 and expression of its regulatory genes in astrocytes (Abildayeva et al., 2006). However, recently, Wang et al. demonstrated that LXRα ï€ negatively regulated two genes encoding key enzymes in the cholesterol biosynthesis pathway (Wang et al., 2008). This variation may be from the different treatment or species.
During the last several years, we have provided experimental evidence supporting the notion that the activation of LXR can result in lipogenesis in goose hepatocytes (Han et al., 2009). However, the potential role that the LXRs might regulate intracellular cholesterol biosynthesis has remained largely undefined. Landes goose (Anser anser) and Sichuan white geese (Anser cygnoides) have different susceptibility to fatty liver, and overfeeding induced a more a huge capability of hepatic steatosis in Landes geese (Han et al., 2008). In order to investigate the role of LXR in regulating the intracellular cholesterol accumulation in goose primary hepatocytes, and to detect the different effect of LXR activation on intracellular cholesterol biosynthesis between goose breeds, we isolated primary hepatocytes from Landes goose (Anser anser) and Sichuan white geese (Anser cygnoides) and investigated the effect of a synthetic LXR agonist, T0901317, on the intracellular cholesterol level, and the gene expression of related genes involved in cholesterol synthesis pathway including SREBP-2 and HMGR.
MATERIALS AND METHODS
PRIMARY HEPATOCYTE ISOLATION and CULTURE
Hepatocytes were isolated from three 10-day-old Landes goose and Sichuan White geese from the Experimental Farm for Waterfowl Breeding at Sichuan Agricultural University using a modification of the "two-step procedure" described by Seglen (Seglen, 1976). The protocol for bird treatment was in accordance with the Canadian Council on Animal Care guidelines (1994). The method differed from that of Seglen in that the liver was removed before the preperfusion step. Cellular viability was greater than 90%, as assessed by the trypan blue dye exclusion test. Freshly isolated hepatocytes were diluted to 1Ã-106 cells/ml. The culture medium was composed of DMEM (containing 4.5 g/L glucose; GIBCO, USA) with 100 IU/L insulin (Sigma, USA), 100 IU/ml penicillin (Sigma, USA), 100 g/ml streptomycin (Sigma, USA), 2 mmol/L glutamine (Sigma, USA), and 100 ml/L fetal bovine serum (Clark, Australia). The hepatocytes were then either plated in 60-mm culture dishes at 3Ã-106 cells per dish for total RNA isolation or plated in 24-well plates at 1Ã-106 cells per well to measure TG levels and cholesterol concentrations. Cultures were incubated at 40℃ in a humidified atmosphere containing 5% CO2, and the media was renewed after 3 h followed by the addition of serum-free media after 24 h. After another 24 h, cells were separately treated with serum-free media supplemented with 0.01, 0.1, 1, or 10 μM T0901317 and incubated for 48 h, while the control sample cells were cultured with serum-free media for 48 h (serum-free media was renewed every 24 hours). After the 48 h incubation, the culture media and cells were cooled on ice and collected for the analysis of extracellular cholesterol concentration in the media, as well as total TG concentration. In each case, the experiments were repeated three times.
MTT ASSAY
The assay for cell viability was performed according to Natali et al. (Natali et al., 2007), with some modifications. Primary cultures of goose hepatocytes were plated at a density of 0.5Ã-104 cells/well in a 96-well culture dish. After 3 h, the serum-rich medium was refreshed, followed by serum-free media after 24 h. Then, cells were separately treated with culture medium supplemented with 0.01, 0.1, 1, or 10 μM T0901317 and incubated for 24, 48, or 72 h, while the control sample cells were cultured with serum-free media (serum-free media was renewed every 24 hours). Then, cell monolayers were incubated for 4 h with 1 mg/ml MTT. Mitochondria of living cells convert the yellow tetrazolium compound to its purple formazan derivative. After removal of the unconverted MTT, the formazan product was dissolved in isopropanol, and the absorbance of formazan dye was measured at 490 nm.
BRDU-INCORPORATION ASSAY
Primary cultures of goose hepatocytes were plated at a density of 0.5Ã-104 cells/well in a 96-well culture dish. After 3 h, the serum-rich medium was refreshed, followed by serum-free media after 24 h. Then, cells were separately treated with culture medium supplemented with 0.01, 0.1, 1, or 10 μM T0901317 and incubated for 48 h, while the control sample cells were cultured with serum-free media (serum-free media was renewed every 24 h. Then, cell monolayers were incubated for 24 h with 10μM BrDU in culture medium. Then cells were washed, fixed and incorporated BrDU detected by a specific ELISA (Roch, USA) in a ELISA reader (Thermo,USA).
ISOLATION of TOTAL RNA and REAL-TIME RT-PCR
Total RNA was isolated from cultured cells using Trizol (Invitrogen, USA) and reverse-transcribed using the PrimerScriptTM RT system kit for real-time PCR (TaKaRa, Japan) using oligo dT primer and random primer according to the manufacturer's instructions. The quantitative real-time PCR reaction contained the newly generated cDNA template, SYBR Premix Ex TaqTM, sterile water, and primers of target genes. Real-time PCR was performed on the Cycler system (one cycle of 95°C for 10 s, followed by 40 cycles of 95°C for 5 s, and 60°C for 40 s). An 80-cycle melt curve was performed, starting at 55°C and increasing by 0.5 degrees every 10 s, to determine primer specificity. Specific primers are listed in Table 1, and were designed according to the goose gene sequences, LXRα: GenBank No. HM138512; SREBP2: GenBank No. EF579754; HMGR: GenBank No. EF635218; 18S: GenBank No. L21170.
Amplicons corresponding to each target were examined by agarose gel to confirm the presence of a unique band of the expected size. Negative controls, which consisted of PCR amplifications with non-reverse transcribed RNA, did not generate any signal. All samples were amplified in duplicate, with the same PCR-mixture and in the same 96-well plate. The cycle threshold variation observed between duplicates was on average 0.12 ± 0.1, thus demonstrating a high level of intra-assay reproducibility. Each sample was also repeated in another 96-well plate. The variation of Ct between the two independent plates was 0.28 ± 0.22, showing a fair level of inter-assay reproducibility as well. PCR products were then diluted 16-fold and were used to generate the calibration curve and the amplification rate (R) for each gene (LXRα, SREBP2, HMGR, and 18S). For each experimental sample, a normalized target gene level (Exp), corresponding to the target gene expression level relative to 18S (housekeeping genes) expression levels, was determined by the 2-ΔΔCt method, as previously described (Livak and Sehmittgen, 2001):
Exp target gene in sample = (1 + Rtarget gene) Ct (target gene in sample) / (1 + R18S) Ct (18S in sample)
For the target gene expression analyses, the normalized target gene expression level for each sample was compared to the positive control sample. Therefore, the final results were expressed as N-fold differences in the normalized target gene expression level between each treated and control sample.
MEASUREMENT of INTRACELLULAR CHOLESTEROL CONCENTRATION
Samples of cultured cell for each treatment were shaked for 1hour using an ultrasonic processor after washed three times with ice-cold phosphate-buffered saline. Total cholesterol was measured by a cholesterol oxidase method using CHOD-PAP assay Kit (BIOSINO,China). Analyses were performed in duplicates.
STATISTICAL ANALYSIS
The data were subjected to two-way ANOVA to assess main vs. interaction effects with T0901317 dose and goose breed as independent variables. If no significant interaction was detected, a one-way ANOVA was performed with T0901317 dose as the independent variable. When a significant interaction or overall effect was detected, differences among individual means were assessed with Duncan's Multiple Range post-hoc test. The level of significance was set at P < 0.05 for all statistical tests. Analysis of variance and the post-hoc tests were performed using the SAS 6.12 package (SAS Institute Inc., Cary, NC). The results are presented as the mean ± SD.
RESULTS
Effect of T0901317 on the VIABILITY of GOOSE HEPATOCYTES
Cell viability was determined by the optical density (OD) value at 490 nm. We can see from Figure 1, T0901317 at concentrations of 0.01, 0.1, 1, or 10 μM had a significant effect (p<0.05) on cell viability as compared to the control group, and cell viability showed an upward trend with increasing T0901317 concentrations. The culture time (24 h, 48 h and 72 h) with 0.01, 0.1, or 10 μM T0901317 had no evident effect on cell viability; in the group treated with 1 μM T0901317, the 48-hour culture time had an evident effect on cell viability as compared to the effects of culturing for 24 h and 72 h.
A BrdU incorporation assay was performed to measure the changed DNA synthesis of treated cells. As shown in Figure 2, Data from BrdU incorporation assays in goose primary hepatocytes showed the DNA synthesis rate did not have evident change (p>0.05) after treatment with 0, 0.01, 0.1, and 1 μM T0901317.
Effect of T0901317 on TOTAL TG CONCENTRATION
As shown in Table 2, all dose of T0901317 induced an increase in total TG accumulation in Landes goose and Sichuan White goose, and the increase in TG accumulation induced by 10 μM T0901317 was the most evident (p<0.05). The effect of incubations with T0901317 on total TG level was higher in Landes goose than in Sichuan White Goose, indicating T0901317 had an evident role in stimulating TG accumulation in goose hepatocytes.
Effect of T0901317 on INTRACELLULAR CHOLESTEROL CONCENTRATION
As shown in Figure 3, the regulation of intracellular cholesterol concentration by T0901317 was similar in Landes goose and Sichuan White Goose. T0901317 at 0.01, 0.1,1 or 10 μM all had a significant effect (p<0.05) on intracellular cholesterol concentration, and the increase in intracellular cholesterol accumulation induced by 1 μM T0901317 was the most evident (p<0.05). Compared with the effect by 1 μM T0901317, 10 μM T0901317 had an inhibiting action. There was no evident difference at the effect of 0, 0.01 and 0.1μM T0901317 on intracellular cholesterol accumulation between Landes goose and Sichuan White Goose, but 1 or 10 μM T0901317 had a more evident influence on intracellular cholesterol level in Landes Goose.
Effect of T0901317 on RELATIVE mRNA LEVELS
Figure 4 presents the effect of T0901317 on the expression of LXRα by quantitative real-time PCR analysis. The gene expression levels of LXRα were up regulated by all dose of T0901317 in the two breeds. There was no evident difference at the effect of T0901317 at 0, 0.01, 0.1 and 1 μM on LXRα gene expression between Landes Goose and Sichuan White Goose, but when the T0901317 concentration reached 10 μM, the effect of T0901317 on the mRNA levels of LXRα was more evident in Landes Goose.
The effect of T0901317 on the expression of SREBP-2 and HMGR was analyzed as Figure 5. The regulation of gene expression by T0901317 was similar in the two breeds. The gene expression levels of SREBP-2 and HMGR were regulated by T0901317 at 0.01, 0.1 and 1 in an uptrend manner, and the effect of T0901317 on gene level increased along with the T0901317 concentration, but when the T0901317 concentration reached 10 μM, the effect decreased. Compared with the effects of T0901317 at other concentrations, the effect of 1 μM T0901317 was most evident. The increase of SREBP-2 and HMGR gene expression level induced by 1 μM T0901317 was higher in Landes Goose than that in Sichuan White Goose.
Discussion
In liver, intracellular cholesterol levels are finely controlled by SREBP-2, a transcription factor whose nuclear fragments are released from membranes by controlled proteolysis. The soluble form of this protein, that is the nuclear form of SREBP-2, enters the nucleus where it activates transcription by binding to 10-bp sterol regulatory elements (SREs) in the enhancer regions of target genes, i.e. HMGR. When cells are overloaded with sterols, SREBP-2 remains bound to the endoplasmic reticulum membranes and, consequently, transcription of the target genes declines (Horton et al., 2002). The present work was, thus, undertaken to determine whether LXR activation could regulate intracellular cholesterol biosynthesis, and whether SREBP-2 plays a regulatory role in LXRα-induced cholesterol synthesis, including controlling the expression patterns of SREBP-2 and HMGR genes. Compared with the effect of 1 μM T0901317, the expression levels of SREBP-2 and HMGR mRNA in goose hepatocytes decreased after incubating with 10 μM T0901317, which is similar with the change of intracellular cholesterol concentrations. This result clearly demonstrates that LXR agonist induces LXRα mRNA levels in liver cells, leading to an increase in the mRNA level of SREBP-2 as well as HMGR encoding enzymes in cholesterol biosynthesis. Our findings are the first to demonstrate an effect of LXR activation on cholesterol synthesis in goose hepatocytes. This is consistent with a previous report, in HepG2 cells, incubation with synthetic LXR agonists increased cholesterol synthesis (Aravindhan et al., 2006). Landes goose showed a more evident TG and cholesterol accumulation in liver cells after LXR activation than Sichuan White goose, this is consistent with the more active susceptibility to fatty liver in Landes goose. HMGR is a target gene of SREBP-2, and the over expression of nSREBP-2 in the liver increased the mRNA level of HMGR by 75-fold (Horton et al., 1998). The regulation of SREBP-2 and HMGR genes by T0901317 was similar in goose primary hepatocytes, which indicated LXR activation may regulate gene expression of HMGR by modulating the SREBP-2.
Because oxysterols are produced in proportion to cellular cholesterol content, LXRs have been proposed to function as sensors in a feed forward pathway that stimulates reverse cholesterol transport and cholesterol excretion in response to high cholesterol levels in the diet. Consistent with this proposal, mice lacking the LXRs gene exhibit diminished cholesterol excretion and increased cholesterol levels in the blood and liver when fed a high-cholesterol diet (Peet et al., 1998b; Alberti et al., 2001). In comparison to the relatively high induced levels of SREBP-1, the amount of SREBP-2 mRNA remained unchanged after LXR agonist treatment (Schultz et al., 2000). T0901317 could activate transcriptional activity of both LXRα and LXRβ (Wojclcka et al., 2007), and there are some reports that the effects of LXR on bile acid synthesis are different between LXRα and LXRβ. However, LXRα has particularly been implicated in the coordination of cholesterol and fatty acid metabolism in the liver, as it provides a molecular means to stimulate the synthesis of fatty acids (de novo lipogenesis) when required for storage of cholesterol in the form of cholesterol esters during dietary sterol overload (Peet et al., 1998b). There has been one report indicating that LXRα plays an important role in the regulation of cholesterol biosynthesis(Wang et al., 2008). Peet and colleagues have shown that mice lacking LXRα lose their ability to adequately react to dietary cholesterol, resulting in massive hepatic accumulation of cholesterol, eventually leading to liver failure (Peet et al., 1998b). This finding underscores the essential function of LXRα in the liver as a sensor of cholesterol. In this study, 0.01, 0.1 and 1 μM T0901317 could up regulate the total TG accumulation and intracellular cholesterol level, however, compared with the effect of 1 μM T0901317, the treatment of high dose T0901317 (10 μM) only could increase the total TG accumulation, but decrease the intracellular cholesterol level. We propose the synthesized intracellular cholesterol induced by 10 μM T0901317 could active de novo lipogenesis. It has been shown that intrahepatic cholesterol can compete with TG for incorporation into the VLDL hydrophobic core, and increasing the amount of cholesterol within the liver cell will alter the composition of VLDL core lipids that are assembled and secreted (Davis et al., 1982; Kang and Davis, 2000). We have found LXR agonist could active the VLDL assembly and secretion (data not shown), and the LXR agonist-induced intracellular cholesterol synthesis may be responsible for the stimulated VLDL assembly and secretion.
In conclusion, LXR activation induced by T0901317 could up-regulate intracellular cholesterol level, gene expression levels of SREBP-2 and HMGR, and the regulation mode of SREBP-2 and HMGR is similar with that of intracellular cholesterol concentration, indicating LXR activation may can stimulate the cholesterol biosynthesis by activating transcription of HMGR gene, and the activation of HMGR transcription induced by T0901317 may be modulated by SREBP-2.
ACKNOWLEDGMENTS
The work was supported by the earmarked fund for Modern Agro-industry Technology Research System (No. nycytx-45-05) and the Research Foundation of Excellent Doctoral Dissertation of Sichuan Agricultural University.
Abildayeva, K., Jansen, P.J., Veronica, H.R., Blok, V.W., Bakker, A.H.F., Ramaekers, F.C.S., Vente, J.D., Groen, A.K., Wellington, C.L., Kuipers, F. and Mulder, M. 2006. 24(S)-hydroxycholesterol participates in a LiverX receptorcontrolled pathway in astrocytes that regulates apolipoprotein E-mediated cholesterol efflux. J. Biol. Chem. 281:12799-12808.
Alberti, S., Schuster, G., Parini, P., Feltkamp, D., Diczfalusy, U., Rudling, M., Angelin, B., Bjorkhem, I., Pettersson, S. and Gustafsson, J.A. 2001. Hepatic cholesterol metabolism and resistance to dietary cholesterol in LXRb-deficient mice. J. Clin. Invest. 107: 565-573.
Aravindhan, K., Webb, C.L., Jaye, M., Ghosh, A., Willette, R.N., DiNardo, N.J. and Jucker, B.M. 2006. Assessing the effects of LXR agonists on cellular cholesterol handling: a stable isotope tracer study. J. Lipid Res. 47:1250-60.
Davis, R.A., McNeal, M.M. and Moses, R.L. Intrahepatic assembly of very low density lipoprotein. 1982. Competition by cholesterol esters for the hydrophobic core. J. Biol. Chem. 257:2634-2640.
DeBose-Boyd, R.A., Ou, J., Goldstein, J.L. and Brown, M.S. 2001. Expression of sterol regulatory element-binding protein 1c (SREBP-1c) mRNA in rat hepatoma cells requires endogenous LXR ligands. Proc. Natl. Acad. Sci. USA. 98:1477-1482.
Forman, B.M., Ruan, B., Chen, J., Schroepfer, Jr. G.J. and Evans, R.M. 1997. The orphan nuclear receptor LXRα is positively and negatively regulated by distinct products of mevalonate metabolism. Proc. Natl. Acad. Sci. USA. 94:10588-10593.
Goldstein, J.L., DeBose-Boyd, R.A. and Brown, M.S. 2006. Protein sensors for membrane sterols. Cell. 124:35-46.
Han, C., Wang, J., Li, L., Wang, L. and Zhang, Z. 2009. The role of LXRα in goose primary hepatocyte lipogenesis. Mol. Cell. Biochem. 322:37-42.
Horton, J.D., Goldstein, J.L. and Brown, M.S. 2002. SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J. Clin. Invest. 109:1125-1131.
Horton, J.D., Shimomura, I., Brown, M.S., Hammer, R.E., Goldstein, J.L. and Shimano, H. 1998. Activation of cholesterol synthesis in preference to fatty acid synthesis in liver and adipose tissue of transgenic mice overproducing sterol regulatory element-binding protein-2. J. Clin. Invest. 101:2331-2339.
Janowski, B.A., Shan, B. and Russell, D.W. 2001. The hypocholesterolemic agent LY295427 reverses suppression of sterol regulatory element-binding protein processing mediated by oxysterols. J. Biol. Chem. 276:45408-45416.
Kang, S. and Davis, R.A. 2000. Cholesterol and hepatic lipoprotein assembly and secretion. Biochi. Biophys. Acta. 1529: 223-230.
Livak, K.J. and Sehmittgen, T.D. 2001. Analysis of relative gene expression data using rea1-time quantitative PCR and the 2-ΔΔCt methed. Methods. 25: 402-408.
Natali, F., Siculella, L., Salvati, S. and Gnoni, G.V. 2007. Oleic acid is a potent inhibitor of fatty acid and cholesterol synthesis in C6 glioma cells. J. Lipid Res. 48:1966-1975.
Peet, D.J., Janowski, B.A. and Mangelsdorf, D.J. 1998. The LXRs: a new class of oxysterol receptors. Curr. Opin. Genet. Dev. 8:571-575.
Peet, D.J., Turley, S.D., Ma, W., Janowski, B.A., Lobaccaro, J.M., Hammer, R.E. and Mangelsdorf, D.J. 1998. Cholesterol and bile acid metabolism are impaired in mice lacking the nuclear oxysterol receptor LXRa. Cell. 93: 693-704.
Schultz, J.R., Tu, H., Luk, A., Repa, J.J., Medina, J.C., Li, L., Schwendner, S., Wang, S., Thoolen, M., Mangelsdorf, D.J., Lustig, K.D. and Shan, B. 2000. Role of LXRs in control of lipogenesis. Gene. Develop. 14:2831-2838.
Seglen, P. 1976. Preparation of isolated rat liver cells. Method. Cell. Biol. 13:29-83.
Repa, J.J. and Mangelsdorf, D.J. 2000.The role of orphan nuclear receptors in the regulation of cholesterol homeostasis. Annu. Rev. Cell Dev. Biol. 16:459-481.
Venkateswaran, A., Laffitte, B.A., Joseph, S.B., Mak, P.A., Wilpitz, D.C., Edwards, P.A. and Tontonoz, P. 2000. Control of cellular cholesterol efflux by the nuclear oxysterol receptor LXRα. Proc. Natl. Acad. Sci. USA. 97:12097-12102.
Wang, Y., Rogers, P.M., Su, C., Varga, G., Stayrook, K.R. and Burris, T.P. 2008. Regulation of cholesterol lipogenesis by the oxysterol receptor, LXRalpha. J. Biol. Chem. 283: 26332-26339.
Wong, J., Quinn, C.M. and Brown, A.J. 2006. SREBP-2 positively regulates transcription of the cholesterol efflux gene, ABCA1, by generating oxysterol ligands for LXR. Biochem. J. 400: 485-491.
Fig. 1. Viability of goose hepatocytes treated with T0901317 for 0-72 h. Different lowercase letters indicate differences among treatments with P<0.05. After 24 h in serum-free medium, hepatocytes were incubated for 0-72 h in either media with nothing added as a control or with T0901317 added to a concentration of 0.01, 0.1, 1, or 10 μΜ.
Fig. 2. Viability of goose hepatocytes treated with 1μΜ T0901317 for 48 h by BrDU-incorporation assay. Different lowercase letters indicate differences among treatments with P<0.05. After 24 h in serum-free medium, hepatocytes were incubated for 48 h in either media with nothing added as a control or with 1 μΜ T0901317.
Fig. 3. Intracellular cholesterol concentrations of goose primary hepatocytes treated with T0901317. Different lowercase letters indicate statistically significant differences between treatments with P<0.05; different lowercase and uppercase letters in the same treatment indicate statistically significant differences between the two breeds with P<0.05. After 24 h in serum-free medium, hepatocytes were incubated for 48 h in either media with nothing added as a control or with T0901317 added to a concentration of 0.01, 0.1, 1, or 10 μΜ.
Fig. 4. Regulation of LXRα mRNA level by T0901317 in goose primary hepatocytes. Different lowercase letters indicate statistically significant differences between treatments with P<0.05; different lowercase and uppercase letters in the same treatment indicate statistically significant differences between the two breeds with P<0.05. After 24 h in serum-free medium, hepatocytes were incubated for 48 h in either media with nothing added as a control or with T0901317 added to a concentration of 0.01, 0.1, 1, or 10 μΜ.
Fig. 5. Regulation of SREBP-2 and HMGR mRNA levels by T0901317 in goose primary hepatocytes. After 24 h in serum-free medium, hepatocytes were incubated for 48 h in either media with nothing added as a control or with T0901317 added to a concentration of 0.01, 0.1, 1, or 10 μΜ.
Table 1 Primer sequences for real-time PCR
Gene Name
Primer (5'-3')
Product size (bp)
SREBP-2
Upstream
GGACAGATGCCAAGATGC
150
Downstream
GGTCAATGCCCTTCAACA
HMGR
Upstream
TATCCGCTTTCAGTCAAGAACAG
183
Downstream
GACTTCCCTCTTCCTTCTATCCAG
LXRα
Upstream
CCCAGCCCTTCCCACAAACT
156
Downstream
CTGCCTCGCTTCACGGTTATTAG
18S
Upstream
TTGGTGGAGCGATTTGTC
129
Downstream
ATCTCGGGTGGCTGAACG
Table 2 Effect of LXRα agonist on TG content in Goose hepatocytes
T0901317（μM）
Sichuan White Goose
Landes Goose
0.00
0.70±0.064e
0.91±0.055e
0.01
0.89±0.020d
1.07±0.030D
0.10
0.97±0.035c
1.38±0.042C
1.00
1.16±0.035b
1.58±0.051B
10.00
1.22±0.020a
1.67±0.025A
Note: Different lowercase letters in the same array indicate statistically significant differences between treatments with P<0.05; different lowercase and uppercase letters in the same row indicate statistically significant differences between the two breeds with P<0.05.
